Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305250711:

Variant ID: vg0305250711 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 5250711
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.04, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTCACACATCACTGATCAGGAACACGACTCGACCTGTACGTAGTAGGGTTTAACTTACCACCGGTAACCGCGCGGTTACCGCGGTTACCGGGCTTATC[G/A]
CGGGGGTACGGTAATATAAATACCGCGGTAACCTCCTTAAATACAAATAAATTTAAAAAATAATTTAAATTTTTGATAAATTTTACACGGTTTTGTACGG

Reverse complement sequence

CCGTACAAAACCGTGTAAAATTTATCAAAAATTTAAATTATTTTTTAAATTTATTTGTATTTAAGGAGGTTACCGCGGTATTTATATTACCGTACCCCCG[C/T]
GATAAGCCCGGTAACCGCGGTAACCGCGCGGTTACCGGTGGTAAGTTAAACCCTACTACGTACAGGTCGAGTCGTGTTCCTGATCAGTGATGTGTGAGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.90%	8.10%	2.60%	64.30%	NA
All Indica	2759	1.70%	0.10%	1.92%	96.30%	NA
All Japonica	1512	72.20%	24.40%	2.25%	1.19%	NA
Aus	269	0.70%	0.40%	8.55%	90.33%	NA
Indica I	595	0.50%	0.00%	3.19%	96.30%	NA
Indica II	465	4.70%	0.00%	2.80%	92.47%	NA
Indica III	913	0.50%	0.10%	0.44%	98.90%	NA
Indica Intermediate	786	2.00%	0.30%	2.16%	95.55%	NA
Temperate Japonica	767	95.80%	1.80%	1.56%	0.78%	NA
Tropical Japonica	504	51.40%	44.80%	2.58%	1.19%	NA
Japonica Intermediate	241	40.20%	53.50%	3.73%	2.49%	NA
VI/Aromatic	96	7.30%	5.20%	7.29%	80.21%	NA
Intermediate	90	36.70%	7.80%	6.67%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0305250711	G -> A	LOC_Os03g10280.1	upstream_gene_variant ; 4965.0bp to feature; MODIFIER	silent_mutation	Average:82.849; most accessible tissue: Callus, score: 97.96	N	N	N	N
vg0305250711	G -> A	LOC_Os03g10290.1	upstream_gene_variant ; 1769.0bp to feature; MODIFIER	silent_mutation	Average:82.849; most accessible tissue: Callus, score: 97.96	N	N	N	N
vg0305250711	G -> A	LOC_Os03g10300.1	upstream_gene_variant ; 2763.0bp to feature; MODIFIER	silent_mutation	Average:82.849; most accessible tissue: Callus, score: 97.96	N	N	N	N
vg0305250711	G -> A	LOC_Os03g10290-LOC_Os03g10300	intergenic_region ; MODIFIER	silent_mutation	Average:82.849; most accessible tissue: Callus, score: 97.96	N	N	N	N
vg0305250711	G -> DEL	N	N	silent_mutation	Average:82.849; most accessible tissue: Callus, score: 97.96	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0305250711	6.27E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	8.85E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	1.95E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	2.20E-06	NA	mr1227	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	3.62E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	2.18E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	8.36E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	3.07E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	8.73E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	7.78E-07	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	4.95E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	1.09E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	8.91E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	2.53E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	5.06E-07	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	6.80E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	2.76E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	2.15E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	9.54E-08	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	2.43E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	8.02E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	3.72E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	7.50E-08	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	4.22E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711	NA	1.11E-08	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251