\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305250711:

Variant ID: vg0305250711 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5250711
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.04, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCACACATCACTGATCAGGAACACGACTCGACCTGTACGTAGTAGGGTTTAACTTACCACCGGTAACCGCGCGGTTACCGCGGTTACCGGGCTTATC[G/A]
CGGGGGTACGGTAATATAAATACCGCGGTAACCTCCTTAAATACAAATAAATTTAAAAAATAATTTAAATTTTTGATAAATTTTACACGGTTTTGTACGG

Reverse complement sequence

CCGTACAAAACCGTGTAAAATTTATCAAAAATTTAAATTATTTTTTAAATTTATTTGTATTTAAGGAGGTTACCGCGGTATTTATATTACCGTACCCCCG[C/T]
GATAAGCCCGGTAACCGCGGTAACCGCGCGGTTACCGGTGGTAAGTTAAACCCTACTACGTACAGGTCGAGTCGTGTTCCTGATCAGTGATGTGTGAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.90% 8.10% 2.60% 64.30% NA
All Indica  2759 1.70% 0.10% 1.92% 96.30% NA
All Japonica  1512 72.20% 24.40% 2.25% 1.19% NA
Aus  269 0.70% 0.40% 8.55% 90.33% NA
Indica I  595 0.50% 0.00% 3.19% 96.30% NA
Indica II  465 4.70% 0.00% 2.80% 92.47% NA
Indica III  913 0.50% 0.10% 0.44% 98.90% NA
Indica Intermediate  786 2.00% 0.30% 2.16% 95.55% NA
Temperate Japonica  767 95.80% 1.80% 1.56% 0.78% NA
Tropical Japonica  504 51.40% 44.80% 2.58% 1.19% NA
Japonica Intermediate  241 40.20% 53.50% 3.73% 2.49% NA
VI/Aromatic  96 7.30% 5.20% 7.29% 80.21% NA
Intermediate  90 36.70% 7.80% 6.67% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305250711 G -> A LOC_Os03g10280.1 upstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:82.849; most accessible tissue: Callus, score: 97.96 N N N N
vg0305250711 G -> A LOC_Os03g10290.1 upstream_gene_variant ; 1769.0bp to feature; MODIFIER silent_mutation Average:82.849; most accessible tissue: Callus, score: 97.96 N N N N
vg0305250711 G -> A LOC_Os03g10300.1 upstream_gene_variant ; 2763.0bp to feature; MODIFIER silent_mutation Average:82.849; most accessible tissue: Callus, score: 97.96 N N N N
vg0305250711 G -> A LOC_Os03g10290-LOC_Os03g10300 intergenic_region ; MODIFIER silent_mutation Average:82.849; most accessible tissue: Callus, score: 97.96 N N N N
vg0305250711 G -> DEL N N silent_mutation Average:82.849; most accessible tissue: Callus, score: 97.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305250711 6.27E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 8.85E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 1.95E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 2.20E-06 NA mr1227 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 3.62E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 2.18E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 8.36E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 3.07E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 8.73E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 7.78E-07 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 4.95E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 1.09E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 8.91E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 2.53E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 5.06E-07 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 6.80E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 2.76E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 2.15E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 9.54E-08 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 2.43E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 8.02E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 3.72E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 7.50E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 4.22E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305250711 NA 1.11E-08 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251