\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305235129:

Variant ID: vg0305235129 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5235129
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTAACCTGTGGCTTCAGCACCACCGCCTCGCTGACCGCCCACGTGTGGGTCGTCGCCTCCCACAAACATCCCTCTACCTACATTTATCGATCTTCTCT[C/T]
TCTTCCTCCCCCCCAACTCCCCTATGCACTCCCATCACAATCTAGGACCTTAAACCCTAACTTGTTCGGCCATCCCCCATCATCAGAGCTGAGTAATTAA

Reverse complement sequence

TTAATTACTCAGCTCTGATGATGGGGGATGGCCGAACAAGTTAGGGTTTAAGGTCCTAGATTGTGATGGGAGTGCATAGGGGAGTTGGGGGGGAGGAAGA[G/A]
AGAGAAGATCGATAAATGTAGGTAGAGGGATGTTTGTGGGAGGCGACGACCCACACGTGGGCGGTCAGCGAGGCGGTGGTGCTGAAGCCACAGGTTAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 3.10% 24.38% 27.74% NA
All Indica  2759 18.80% 0.10% 35.88% 45.20% NA
All Japonica  1512 80.20% 9.50% 6.55% 3.77% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 8.40% 0.00% 24.87% 66.72% NA
Indica II  465 19.80% 0.00% 31.83% 48.39% NA
Indica III  913 25.30% 0.10% 45.24% 29.35% NA
Indica Intermediate  786 18.70% 0.10% 35.75% 45.42% NA
Temperate Japonica  767 95.30% 1.20% 2.61% 0.91% NA
Tropical Japonica  504 74.60% 6.20% 10.32% 8.93% NA
Japonica Intermediate  241 44.00% 42.70% 11.20% 2.07% NA
VI/Aromatic  96 65.60% 0.00% 32.29% 2.08% NA
Intermediate  90 58.90% 2.20% 33.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305235129 C -> T LOC_Os03g10270.1 downstream_gene_variant ; 1475.0bp to feature; MODIFIER silent_mutation Average:23.041; most accessible tissue: Minghui63 root, score: 36.81 N N N N
vg0305235129 C -> T LOC_Os03g10270-LOC_Os03g10280 intergenic_region ; MODIFIER silent_mutation Average:23.041; most accessible tissue: Minghui63 root, score: 36.81 N N N N
vg0305235129 C -> DEL N N silent_mutation Average:23.041; most accessible tissue: Minghui63 root, score: 36.81 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305235129 NA 2.39E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 3.76E-08 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 3.64E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 1.94E-11 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 1.63E-09 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 1.09E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 8.94E-07 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 6.87E-10 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 8.72E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 2.74E-11 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 1.91E-06 1.84E-10 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 8.79E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 7.20E-10 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 4.33E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 1.22E-11 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 2.18E-06 3.72E-09 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 2.51E-09 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 2.08E-06 1.10E-11 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 2.32E-06 7.81E-13 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 1.57E-11 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 5.29E-06 4.13E-12 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 3.00E-10 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 2.42E-11 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 9.70E-07 6.11E-14 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 5.34E-07 1.92E-13 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 4.10E-06 3.30E-11 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 8.77E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 5.90E-13 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 6.78E-07 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 3.02E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 5.23E-09 mr1861_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 8.85E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305235129 NA 5.61E-09 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251