Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305203343:

Variant ID: vg0305203343 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5203343
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGAAAGTACTCCAAGGAAGAAAAGGGTGGGTTGACTAGAAGTACTTCCAGAGAAGAGCATGCCTCCAGGTATTCAAAGCGTGGATTGTAGTCGTCACC[T/C]
CGCGGGCTTGCAGCAATCACTCAGCTGTGCACATCATGCTCTTGCTTATTAAAAAAGTACATTGCATCCTGAAAACGGAGTGGCTCATTTCCCCAAGAGG

Reverse complement sequence

CCTCTTGGGGAAATGAGCCACTCCGTTTTCAGGATGCAATGTACTTTTTTAATAAGCAAGAGCATGATGTGCACAGCTGAGTGATTGCTGCAAGCCCGCG[A/G]
GGTGACGACTACAATCCACGCTTTGAATACCTGGAGGCATGCTCTTCTCTGGAAGTACTTCTAGTCAACCCACCCTTTTCTTCCTTGGAGTACTTTCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 37.70% 0.21% 0.08% NA
All Indica  2759 91.00% 8.70% 0.14% 0.14% NA
All Japonica  1512 1.40% 98.30% 0.26% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 92.60% 7.10% 0.34% 0.00% NA
Indica II  465 95.70% 3.90% 0.22% 0.22% NA
Indica III  913 86.70% 13.10% 0.00% 0.11% NA
Indica Intermediate  786 92.10% 7.50% 0.13% 0.25% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.20% 0.40% 0.00% NA
Japonica Intermediate  241 2.90% 96.30% 0.83% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305203343 T -> C LOC_Os03g10224.1 3_prime_UTR_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:66.15; most accessible tissue: Minghui63 flower, score: 82.376 N N N N
vg0305203343 T -> C LOC_Os03g10230.1 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:66.15; most accessible tissue: Minghui63 flower, score: 82.376 N N N N
vg0305203343 T -> C LOC_Os03g10220.1 intron_variant ; MODIFIER silent_mutation Average:66.15; most accessible tissue: Minghui63 flower, score: 82.376 N N N N
vg0305203343 T -> DEL N N silent_mutation Average:66.15; most accessible tissue: Minghui63 flower, score: 82.376 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305203343 NA 1.98E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.55E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 9.45E-31 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 4.01E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 7.31E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 9.64E-09 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 4.97E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.54E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 2.53E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.44E-18 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.78E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 3.11E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 5.85E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 3.43E-39 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 2.06E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 2.06E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 8.80E-23 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 3.09E-36 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.23E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.51E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 9.86E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 3.19E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 1.25E-07 2.19E-09 mr1993 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 6.05E-32 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 3.29E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 5.14E-38 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.24E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 8.83E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 4.86E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 6.85E-58 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305203343 NA 1.60E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251