\
| Variant ID: vg0305152558 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5152558 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 117. )
TTTTTTAAAAAACACAATTTACAGTTTAAAAATTGTGCGCGTGAGAACCGAGGCGGAGGAGCTGGGGGCCAGCAATTCTAAACACTAATATTCCACATTT[T/G,A]
CGTATCAACGTCCATTCTACATGTTTGGGCGAGAAAATAAAAAAAAAACCTCGAAACACATGGCTCGAATGAGCTTGTATTGAGTTTGGCTCGATCAACT
AGTTGATCGAGCCAAACTCAATACAAGCTCATTCGAGCCATGTGTTTCGAGGTTTTTTTTTTATTTTCTCGCCCAAACATGTAGAATGGACGTTGATACG[A/C,T]
AAATGTGGAATATTAGTGTTTAGAATTGCTGGCCCCCAGCTCCTCCGCCTCGGTTCTCACGCGCACAATTTTTAAACTGTAAATTGTGTTTTTTAAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 33.30% | 0.02% | 0.00% | A: 0.02% |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 0.00% | 0.00% | A: 1.04% |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305152558 | T -> A | LOC_Os03g10150.1 | upstream_gene_variant ; 520.0bp to feature; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> A | LOC_Os03g10160.1 | upstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> A | LOC_Os03g10170.1 | upstream_gene_variant ; 4946.0bp to feature; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> A | LOC_Os03g10150-LOC_Os03g10160 | intergenic_region ; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> G | LOC_Os03g10150.1 | upstream_gene_variant ; 520.0bp to feature; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> G | LOC_Os03g10160.1 | upstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> G | LOC_Os03g10170.1 | upstream_gene_variant ; 4946.0bp to feature; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| vg0305152558 | T -> G | LOC_Os03g10150-LOC_Os03g10160 | intergenic_region ; MODIFIER | silent_mutation | Average:65.063; most accessible tissue: Callus, score: 86.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305152558 | NA | 5.97E-90 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.15E-40 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.52E-31 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.02E-76 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.14E-57 | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 5.88E-33 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.97E-44 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.37E-90 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.51E-27 | mr1145 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 8.47E-22 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.62E-95 | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.34E-28 | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | 5.11E-07 | NA | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.87E-27 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.16E-33 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.01E-29 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.45E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.95E-25 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.90E-33 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.69E-19 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.70E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.37E-93 | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.81E-21 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 9.93E-61 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.62E-34 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 5.82E-71 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.64E-37 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.75E-12 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.33E-46 | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.91E-108 | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.46E-103 | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.21E-34 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 8.79E-99 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 8.28E-68 | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 7.40E-39 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.09E-38 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.16E-53 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.22E-41 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.93E-38 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.34E-34 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.99E-114 | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 8.05E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.58E-40 | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.62E-25 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.98E-52 | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.15E-29 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 3.70E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.19E-39 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.38E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.78E-17 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.54E-62 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 9.75E-24 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.10E-46 | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.74E-26 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.41E-45 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.79E-60 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.93E-123 | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 8.75E-100 | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.32E-48 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.40E-18 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.57E-85 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 4.44E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 2.56E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 1.76E-23 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305152558 | NA | 6.23E-52 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |