\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305127472:

Variant ID: vg0305127472 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5127472
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCCACCTTTTTTAATTATTTTTTGTGTAGTTGACATATGGGTCCCACTATTTTTATTATTTTTTGGGGATAAAATTGCCATGTAAGCGCCACGTCATT[A/G]
CCACGTGGGACGAAGACCTAGTCAAATGAGCCACGTATATGCCATGTCAGTCAAAACCGGCCTCCATACTACTGAGGGACCTCGTTTGTCCGGTTTTGTA

Reverse complement sequence

TACAAAACCGGACAAACGAGGTCCCTCAGTAGTATGGAGGCCGGTTTTGACTGACATGGCATATACGTGGCTCATTTGACTAGGTCTTCGTCCCACGTGG[T/C]
AATGACGTGGCGCTTACATGGCAATTTTATCCCCAAAAAATAATAAAAATAGTGGGACCCATATGTCAACTACACAAAAAATAATTAAAAAAGGTGGGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 21.90% 1.16% 0.59% NA
All Indica  2759 96.70% 0.90% 1.41% 1.01% NA
All Japonica  1512 34.90% 64.20% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 0.20% 1.18% 1.18% NA
Indica II  465 95.30% 3.40% 0.86% 0.43% NA
Indica III  913 97.60% 0.00% 1.53% 0.88% NA
Indica Intermediate  786 95.80% 1.00% 1.78% 1.40% NA
Temperate Japonica  767 3.70% 95.80% 0.52% 0.00% NA
Tropical Japonica  504 67.70% 31.50% 0.79% 0.00% NA
Japonica Intermediate  241 65.60% 31.50% 2.90% 0.00% NA
VI/Aromatic  96 78.10% 20.80% 1.04% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305127472 A -> DEL N N silent_mutation Average:91.685; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0305127472 A -> G LOC_Os03g10120.1 upstream_gene_variant ; 2853.0bp to feature; MODIFIER silent_mutation Average:91.685; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0305127472 A -> G LOC_Os03g10120.2 upstream_gene_variant ; 2853.0bp to feature; MODIFIER silent_mutation Average:91.685; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0305127472 A -> G LOC_Os03g10120.3 upstream_gene_variant ; 2853.0bp to feature; MODIFIER silent_mutation Average:91.685; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N
vg0305127472 A -> G LOC_Os03g10120-LOC_Os03g10140 intergenic_region ; MODIFIER silent_mutation Average:91.685; most accessible tissue: Minghui63 panicle, score: 96.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0305127472 A G -0.04 -0.03 -0.02 -0.04 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305127472 NA 4.06E-39 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 4.75E-24 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.94E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 4.01E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 8.91E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.47E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.79E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.60E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.04E-34 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 9.32E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.36E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 6.93E-65 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.32E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 5.74E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.25E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.21E-26 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 5.29E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.30E-52 mr1486_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.83E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 6.09E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.58E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.79E-46 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.48E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 6.21E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 7.02E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 5.14E-07 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 6.47E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.23E-29 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 1.46E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 4.17E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 2.96E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 9.93E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 9.79E-07 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305127472 NA 6.50E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251