\
| Variant ID: vg0305070861 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5070861 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 222. )
TAGTTGTAATGATATCACTTGAGCATCAACACCTTTGTAATCCTTGGGACCTATTTCTTTCATTCAACTCAATAAAATTATTAGTCCTAATGATCCGGTT[G/A]
TCAACCTCCACATGTTGACCAACCGATCGCATGTATAAAAGGATATGAATACATGATGAGTATTAATCAACACCACAAGTGTCATATACTCAAATATTTA
TAAATATTTGAGTATATGACACTTGTGGTGTTGATTAATACTCATCATGTATTCATATCCTTTTATACATGCGATCGGTTGGTCAACATGTGGAGGTTGA[C/T]
AACCGGATCATTAGGACTAATAATTTTATTGAGTTGAATGAAAGAAATAGGTCCCAAGGATTACAAAGGTGTTGATGCTCAAGTGATATCATTACAACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.20% | 34.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305070861 | G -> A | LOC_Os03g10050-LOC_Os03g10060 | intergenic_region ; MODIFIER | silent_mutation | Average:16.542; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305070861 | NA | 1.66E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | NA | 1.21E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | 4.61E-06 | NA | mr1179 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | NA | 8.01E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | NA | 2.16E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | NA | 3.70E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | NA | 4.54E-27 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305070861 | NA | 1.11E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |