\
| Variant ID: vg0305058156 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5058156 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 115. )
ATTAGCTGAGGTAGAAGTGATATAAATATTACTATTTAATTCTTAGCATAAATTGGAAAAAACTACATAAGTGCTATACTCCATGGGTCCCAAAATGTTG[C/T]
GTGCAATACTTCATCCGTCTTGAAATATATAGGGTTAATTAGATCCATGCCATTGCAAAGTTGCCTATTCATGTTTGTCTATTCGTAATCGTGCCACTGG
CCAGTGGCACGATTACGAATAGACAAACATGAATAGGCAACTTTGCAATGGCATGGATCTAATTAACCCTATATATTTCAAGACGGATGAAGTATTGCAC[G/A]
CAACATTTTGGGACCCATGGAGTATAGCACTTATGTAGTTTTTTCCAATTTATGCTAAGAATTAAATAGTAATATTTATATCACTTCTACCTCAGCTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 33.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 55.00% | 45.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 33.20% | 66.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 52.70% | 47.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305058156 | C -> T | LOC_Os03g10040-LOC_Os03g10050 | intergenic_region ; MODIFIER | silent_mutation | Average:44.578; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305058156 | NA | 1.26E-06 | Yield | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0305058156 | NA | 6.93E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 2.72E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 7.37E-06 | mr1252 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 8.95E-08 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 4.99E-06 | mr1530 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 1.49E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 5.54E-08 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 4.18E-09 | mr1745 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 9.84E-08 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 9.19E-10 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 2.75E-07 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 1.42E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 8.63E-07 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305058156 | NA | 9.16E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |