\
| Variant ID: vg0305023781 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5023781 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, C: 0.03, T: 0.02, others allele: 0.00, population size: 120. )
AAATTCAAGTTGATTTACCAAGCTTTTGCAATCAATTGCAGTGAATTCAAGAAGATGATAGTAGTAACTTCTCTTCTCTAGTCAGTAACTCACTACTAGT[A/C]
CTCACTCCGTCCTAGAATATAAGTATTTTTTTTAAGTATAGTGACAAGTCAACCATTTTTAACTTTAATTATTAATAACAACAAAATAAAAAAAATTAAT
ATTAATTTTTTTTATTTTGTTGTTATTAATAATTAAAGTTAAAAATGGTTGACTTGTCACTATACTTAAAAAAAATACTTATATTCTAGGACGGAGTGAG[T/G]
ACTAGTAGTGAGTTACTGACTAGAGAAGAGAAGTTACTACTATCATCTTCTTGAATTCACTGCAATTGATTGCAAAAGCTTGGTAAATCAACTTGAATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.10% | 39.50% | 3.15% | 12.25% | NA |
| All Indica | 2759 | 75.90% | 23.70% | 0.22% | 0.11% | NA |
| All Japonica | 1512 | 0.50% | 53.80% | 8.73% | 37.04% | NA |
| Aus | 269 | 1.10% | 98.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.10% | 34.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 72.90% | 26.30% | 0.38% | 0.38% | NA |
| Temperate Japonica | 767 | 0.70% | 85.80% | 1.83% | 11.73% | NA |
| Tropical Japonica | 504 | 0.20% | 18.80% | 18.25% | 62.70% | NA |
| Japonica Intermediate | 241 | 0.40% | 24.90% | 10.79% | 63.90% | NA |
| VI/Aromatic | 96 | 1.00% | 92.70% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 30.00% | 47.80% | 11.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305023781 | A -> C | LOC_Os03g10010-LOC_Os03g10030 | intergenic_region ; MODIFIER | silent_mutation | Average:45.359; most accessible tissue: Callus, score: 86.073 | N | N | N | N |
| vg0305023781 | A -> DEL | N | N | silent_mutation | Average:45.359; most accessible tissue: Callus, score: 86.073 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305023781 | NA | 2.42E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.83E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.25E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.88E-27 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 4.20E-23 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.16E-30 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.50E-59 | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 6.80E-36 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.37E-33 | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.22E-45 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.10E-45 | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.03E-44 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.50E-21 | mr1131 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.42E-12 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.97E-41 | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.23E-18 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.29E-13 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 6.92E-16 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.27E-30 | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.07E-30 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.45E-33 | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.60E-34 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.86E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.47E-29 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.24E-62 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.41E-26 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.63E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.31E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 4.56E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.73E-34 | mr1404 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.76E-24 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.47E-27 | mr1426 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.66E-30 | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.74E-41 | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.54E-25 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.57E-31 | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.55E-40 | mr1620 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 4.32E-14 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.01E-62 | mr1671 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.50E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 4.57E-12 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.38E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 9.75E-31 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.00E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.11E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.80E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.68E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.79E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.26E-34 | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.06E-13 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.32E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 6.89E-66 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.11E-64 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.17E-46 | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.76E-33 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.53E-76 | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.39E-44 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.21E-61 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.23E-56 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.23E-53 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.15E-63 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.99E-53 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 6.08E-21 | mr1131_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.37E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 7.86E-56 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | 4.20E-06 | 7.74E-17 | mr1147_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.94E-20 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.33E-54 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.19E-42 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.02E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 5.98E-41 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.89E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.74E-60 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.05E-25 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | 4.36E-06 | 1.65E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.88E-30 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.36E-44 | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 4.01E-48 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.37E-20 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.93E-48 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 2.88E-07 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.02E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | 7.40E-06 | 3.64E-77 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.10E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 3.76E-16 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 6.02E-12 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.53E-67 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.23E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305023781 | NA | 1.51E-36 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |