\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304997671:

Variant ID: vg0304997671 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4997671
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTTACATATCCGATTCAAATTTGAATTTGAATTCAAATTTTTTATATATAATATTTCTATACATAAATTTTTCTAACTTCTGTTTTTTAAAAAAATTT[G/A]
TGTGGTCTACCGTAGTAAAAAGAGGGGAAGGGGAGGAGGAAGGGGGAGAAGAGGAAGGAGTACATATAGTAGTATAGGGGAGAGGGTGGGCGGGTGATCG

Reverse complement sequence

CGATCACCCGCCCACCCTCTCCCCTATACTACTATATGTACTCCTTCCTCTTCTCCCCCTTCCTCCTCCCCTTCCCCTCTTTTTACTACGGTAGACCACA[C/T]
AAATTTTTTTAAAAAACAGAAGTTAGAAAAATTTATGTATAGAAATATTATATATAAAAAATTTGAATTCAAATTCAAATTTGAATCGGATATGTAAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 22.00% 6.81% 0.15% NA
All Indica  2759 51.60% 36.90% 11.20% 0.22% NA
All Japonica  1512 99.30% 0.30% 0.46% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 22.40% 59.80% 17.82% 0.00% NA
Indica II  465 37.40% 55.30% 7.31% 0.00% NA
Indica III  913 75.80% 15.90% 8.21% 0.11% NA
Indica Intermediate  786 54.20% 33.20% 11.96% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.20% 0.60% 0.00% NA
Japonica Intermediate  241 97.90% 0.40% 1.66% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 78.90% 15.60% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304997671 G -> A LOC_Os03g09980.1 intron_variant ; MODIFIER silent_mutation Average:50.374; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg0304997671 G -> DEL N N silent_mutation Average:50.374; most accessible tissue: Minghui63 root, score: 80.76 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304997671 NA 6.21E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0304997671 NA 3.59E-06 Yield Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0304997671 NA 4.13E-13 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 8.33E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 1.88E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 3.29E-07 NA mr1103_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 4.07E-06 4.36E-20 mr1131_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 5.70E-06 mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 1.18E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 2.22E-09 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 3.19E-06 2.22E-26 mr1233_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 4.66E-06 2.25E-08 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 3.06E-06 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 4.61E-06 1.06E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 1.17E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 2.61E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 9.49E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 2.57E-12 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 2.62E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 4.37E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 3.48E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304997671 NA 2.47E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251