\
| Variant ID: vg0304944718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4944718 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.35, others allele: 0.00, population size: 213. )
CGAAAGCACAAACTATTCATAAATAGCCAAAAAAATCCGTGCCTTCCTGCCTTGGAAGTGATGTCCCGGGACCATCATCCCTGAAATTAAAGAGTAAAAA[G/A]
AGGGGAATTTAGTCTTATTTGTTAGTACTAGTATTAAAATAACCCTCTTTTTTGCGGTGGTGTTACAATAATCCGAACTTGCGTGTTATAAGAGGGACTT
AAGTCCCTCTTATAACACGCAAGTTCGGATTATTGTAACACCACCGCAAAAAAGAGGGTTATTTTAATACTAGTACTAACAAATAAGACTAAATTCCCCT[C/T]
TTTTTACTCTTTAATTTCAGGGATGATGGTCCCGGGACATCACTTCCAAGGCAGGAAGGCACGGATTTTTTTGGCTATTTATGAATAGTTTGTGCTTTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 40.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 10.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 74.00% | 25.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 47.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304944718 | G -> A | LOC_Os03g09910.1 | downstream_gene_variant ; 3681.0bp to feature; MODIFIER | silent_mutation | Average:44.77; most accessible tissue: Callus, score: 86.241 | N | N | N | N |
| vg0304944718 | G -> A | LOC_Os03g09930.1 | downstream_gene_variant ; 1605.0bp to feature; MODIFIER | silent_mutation | Average:44.77; most accessible tissue: Callus, score: 86.241 | N | N | N | N |
| vg0304944718 | G -> A | LOC_Os03g09930.2 | downstream_gene_variant ; 1605.0bp to feature; MODIFIER | silent_mutation | Average:44.77; most accessible tissue: Callus, score: 86.241 | N | N | N | N |
| vg0304944718 | G -> A | LOC_Os03g09920.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.77; most accessible tissue: Callus, score: 86.241 | N | N | N | N |
| vg0304944718 | G -> A | LOC_Os03g09920.2 | intron_variant ; MODIFIER | silent_mutation | Average:44.77; most accessible tissue: Callus, score: 86.241 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304944718 | NA | 8.79E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.17E-30 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 9.14E-40 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.29E-57 | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.06E-30 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.32E-40 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.04E-14 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.12E-44 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 3.46E-21 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.30E-30 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.31E-26 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.25E-19 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.95E-35 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.47E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.22E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 6.57E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.30E-56 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.81E-41 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.35E-32 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.61E-35 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.48E-58 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | 3.35E-06 | NA | mr1702 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.41E-61 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.17E-36 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.48E-94 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.91E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.32E-56 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.92E-75 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.61E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.61E-40 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.24E-59 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 3.37E-102 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.88E-46 | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.22E-36 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.87E-37 | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.35E-32 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.40E-34 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.45E-71 | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 6.58E-38 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.02E-38 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.75E-54 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 6.51E-44 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 6.70E-39 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 8.73E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.60E-25 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.11E-58 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.95E-77 | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.39E-41 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.33E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.09E-61 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.58E-25 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.39E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.02E-46 | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.19E-45 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.84E-93 | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.57E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.72E-80 | mr1563_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.78E-47 | mr1591_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 5.49E-68 | mr1594_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.06E-46 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 3.52E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 7.20E-80 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 7.34E-59 | mr1695_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 6.93E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 4.17E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 7.00E-65 | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.92E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.38E-91 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.21E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 7.52E-91 | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.55E-17 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 1.59E-36 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.18E-50 | mr1890_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304944718 | NA | 2.27E-31 | mr1891_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |