\
| Variant ID: vg0304934277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4934277 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, A: 0.18, others allele: 0.00, population size: 109. )
CGCAATTTACATGCAAACTGTCCAATTGGTTTTTTCGTCCATATTTAATATTTCATGCTTATGTCTAAATATTTGATGTGACGAATTTTTTGGAAGTTTG[T/A,C]
AGGGAACCAAACACTGCCATAATCGTAAGACTTTTCTCTGGTTCTCAAGGATGCGTCCCTTGATTTTTTTTCTTTGGGAAAATTAATTATTCGCGTCAAC
GTTGACGCGAATAATTAATTTTCCCAAAGAAAAAAAATCAAGGGACGCATCCTTGAGAACCAGAGAAAAGTCTTACGATTATGGCAGTGTTTGGTTCCCT[A/T,G]
CAAACTTCCAAAAAATTCGTCACATCAAATATTTAGACATAAGCATGAAATATTAAATATGGACGAAAAAACCAATTGGACAGTTTGCATGTAAATTGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 41.80% | 0.83% | 6.18% | C: 0.02% |
| All Indica | 2759 | 84.30% | 12.00% | 0.80% | 2.97% | NA |
| All Japonica | 1512 | 0.50% | 99.10% | 0.20% | 0.13% | NA |
| Aus | 269 | 16.40% | 8.90% | 4.83% | 69.89% | NA |
| Indica I | 595 | 97.60% | 1.30% | 0.84% | 0.17% | NA |
| Indica II | 465 | 84.30% | 4.90% | 2.58% | 8.17% | NA |
| Indica III | 913 | 77.50% | 22.10% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 81.90% | 12.30% | 0.38% | 5.34% | NA |
| Temperate Japonica | 767 | 0.70% | 99.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 82.30% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 41.10% | 50.00% | 1.11% | 6.67% | C: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304934277 | T -> C | LOC_Os03g09910.1 | upstream_gene_variant ; 2195.0bp to feature; MODIFIER | silent_mutation | Average:38.146; most accessible tissue: Minghui63 root, score: 78.346 | N | N | N | N |
| vg0304934277 | T -> C | LOC_Os03g09900-LOC_Os03g09910 | intergenic_region ; MODIFIER | silent_mutation | Average:38.146; most accessible tissue: Minghui63 root, score: 78.346 | N | N | N | N |
| vg0304934277 | T -> A | LOC_Os03g09910.1 | upstream_gene_variant ; 2195.0bp to feature; MODIFIER | silent_mutation | Average:38.146; most accessible tissue: Minghui63 root, score: 78.346 | N | N | N | N |
| vg0304934277 | T -> A | LOC_Os03g09900-LOC_Os03g09910 | intergenic_region ; MODIFIER | silent_mutation | Average:38.146; most accessible tissue: Minghui63 root, score: 78.346 | N | N | N | N |
| vg0304934277 | T -> DEL | N | N | silent_mutation | Average:38.146; most accessible tissue: Minghui63 root, score: 78.346 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304934277 | NA | 8.56E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.48E-22 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.08E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.13E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.42E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.58E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.44E-58 | mr1695 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 3.17E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.76E-86 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.44E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 5.88E-30 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.35E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.94E-101 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.83E-45 | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.47E-36 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.54E-35 | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 6.66E-34 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 3.53E-37 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.04E-38 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.74E-42 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 9.09E-43 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.86E-34 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 8.33E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 9.36E-13 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.50E-42 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.50E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.90E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.12E-27 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 9.05E-51 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 3.51E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 4.60E-45 | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 8.20E-57 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.49E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 4.52E-47 | mr1591_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 4.66E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 4.01E-68 | mr1594_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 3.08E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.08E-46 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.36E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.23E-18 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.15E-21 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 3.95E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 7.08E-67 | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 6.52E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 4.38E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 2.63E-88 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 1.35E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 5.94E-18 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 6.80E-35 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304934277 | NA | 6.97E-50 | mr1890_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |