\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304891426:

Variant ID: vg0304891426 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4891426
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCCTTGAGGCAAGTATATGTTTGAAAGATTGGATAATTGGATTTGACGATGATGAAAAAGGTAAAAGATTGACATTATGTAAGGGTATGTATTATAG[C/A]
ATATACTTGATCTCATTTCTTGTGCTTCAATATGCAGGCTATGCAACAGAAGGATCTCGCATTTGTGATTTGGAAGACTATGTTGAATAGTTAAATGCTG

Reverse complement sequence

CAGCATTTAACTATTCAACATAGTCTTCCAAATCACAAATGCGAGATCCTTCTGTTGCATAGCCTGCATATTGAAGCACAAGAAATGAGATCAAGTATAT[G/T]
CTATAATACATACCCTTACATAATGTCAATCTTTTACCTTTTTCATCATCGTCAAATCCAATTATCCAATCTTTCAAACATATACTTGCCTCAAGGGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 18.30% 0.04% 3.03% NA
All Indica  2759 65.30% 31.00% 0.04% 3.73% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 94.10% 1.50% 0.00% 4.46% NA
Indica I  595 30.60% 69.20% 0.17% 0.00% NA
Indica II  465 95.90% 3.90% 0.00% 0.22% NA
Indica III  913 67.40% 22.80% 0.00% 9.86% NA
Indica Intermediate  786 71.00% 27.50% 0.00% 1.53% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 3.10% 1.04% 26.04% NA
Intermediate  90 92.20% 5.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304891426 C -> A LOC_Os03g09820.1 downstream_gene_variant ; 4112.0bp to feature; MODIFIER silent_mutation Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg0304891426 C -> A LOC_Os03g09840.1 downstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg0304891426 C -> A LOC_Os03g09840.2 downstream_gene_variant ; 3097.0bp to feature; MODIFIER silent_mutation Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg0304891426 C -> A LOC_Os03g09830.2 intron_variant ; MODIFIER silent_mutation Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg0304891426 C -> DEL N N silent_mutation Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304891426 NA 1.37E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 3.60E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 1.72E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 1.07E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 8.35E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 1.19E-06 mr1233_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 1.48E-31 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304891426 NA 2.36E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251