\
| Variant ID: vg0304891426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4891426 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
AAACCCTTGAGGCAAGTATATGTTTGAAAGATTGGATAATTGGATTTGACGATGATGAAAAAGGTAAAAGATTGACATTATGTAAGGGTATGTATTATAG[C/A]
ATATACTTGATCTCATTTCTTGTGCTTCAATATGCAGGCTATGCAACAGAAGGATCTCGCATTTGTGATTTGGAAGACTATGTTGAATAGTTAAATGCTG
CAGCATTTAACTATTCAACATAGTCTTCCAAATCACAAATGCGAGATCCTTCTGTTGCATAGCCTGCATATTGAAGCACAAGAAATGAGATCAAGTATAT[G/T]
CTATAATACATACCCTTACATAATGTCAATCTTTTACCTTTTTCATCATCGTCAAATCCAATTATCCAATCTTTCAAACATATACTTGCCTCAAGGGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 18.30% | 0.04% | 3.03% | NA |
| All Indica | 2759 | 65.30% | 31.00% | 0.04% | 3.73% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.07% | NA |
| Aus | 269 | 94.10% | 1.50% | 0.00% | 4.46% | NA |
| Indica I | 595 | 30.60% | 69.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 67.40% | 22.80% | 0.00% | 9.86% | NA |
| Indica Intermediate | 786 | 71.00% | 27.50% | 0.00% | 1.53% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 69.80% | 3.10% | 1.04% | 26.04% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304891426 | C -> A | LOC_Os03g09820.1 | downstream_gene_variant ; 4112.0bp to feature; MODIFIER | silent_mutation | Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0304891426 | C -> A | LOC_Os03g09840.1 | downstream_gene_variant ; 3096.0bp to feature; MODIFIER | silent_mutation | Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0304891426 | C -> A | LOC_Os03g09840.2 | downstream_gene_variant ; 3097.0bp to feature; MODIFIER | silent_mutation | Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0304891426 | C -> A | LOC_Os03g09830.2 | intron_variant ; MODIFIER | silent_mutation | Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0304891426 | C -> DEL | N | N | silent_mutation | Average:32.932; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304891426 | NA | 1.37E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 3.60E-06 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 1.72E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 1.07E-18 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 8.35E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 1.19E-06 | mr1233_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 1.48E-31 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304891426 | NA | 2.36E-10 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |