\
| Variant ID: vg0304878960 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4878960 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACCCTCTATTAATGGAATTTGGTTTATTTTTTGTTCCACCAAAAATGTTTCACCTAGTGTACTCACAATGTTTCACTATGTATAGATCTAATGTTGCTG[C/T]
AGTGAACTAAAATATTCCATTGCAAAAAAAACCCACATATTTTGGAAACTCCCTATTAAGGGAATTCGTTTTATTTTTTGTTCTACCAAAAAAATGTTTC
GAAACATTTTTTTGGTAGAACAAAAAATAAAACGAATTCCCTTAATAGGGAGTTTCCAAAATATGTGGGTTTTTTTTGCAATGGAATATTTTAGTTCACT[G/A]
CAGCAACATTAGATCTATACATAGTGAAACATTGTGAGTACACTAGGTGAAACATTTTTGGTGGAACAAAAAATAAACCAAATTCCATTAATAGAGGGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 0.50% | 0.95% | 0.78% | NA |
| All Indica | 2759 | 99.10% | 0.00% | 0.07% | 0.80% | NA |
| All Japonica | 1512 | 95.90% | 1.50% | 2.58% | 0.07% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.50% | 0.00% | 0.22% | 2.30% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.30% | 2.90% | 4.69% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304878960 | C -> T | LOC_Os03g09810.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.523; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0304878960 | C -> DEL | N | N | silent_mutation | Average:47.523; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304878960 | NA | 2.09E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | 3.80E-06 | 6.46E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 2.11E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 6.75E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 6.07E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 1.45E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 2.59E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 3.01E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 1.64E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304878960 | NA | 6.87E-08 | mr1693_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |