\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304835233:

Variant ID: vg0304835233 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4835233
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTACTGCCATTGGCCACCTAAGGTGTGTTTAGTGCACACTAAAATTAAAAATTTAGTTAAAATTGGAATGATGTGACGGAAAAGTTAAAAGTTTATGT[G/A]
TGTAGAAAAATTTTGATGTGATGAAAAAGTTGAAAGTTTAAAAATAAAGTTTGGAACTAAACATTCTTTAATTACATAAGTAGAATGGAATGCCGCACCA

Reverse complement sequence

TGGTGCGGCATTCCATTCTACTTATGTAATTAAAGAATGTTTAGTTCCAAACTTTATTTTTAAACTTTCAACTTTTTCATCACATCAAAATTTTTCTACA[C/T]
ACATAAACTTTTAACTTTTCCGTCACATCATTCCAATTTTAACTAAATTTTTAATTTTAGTGTGCACTAAACACACCTTAGGTGGCCAATGGCAGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 49.10% 0.11% 0.32% NA
All Indica  2759 81.30% 18.20% 0.07% 0.43% NA
All Japonica  1512 0.10% 99.70% 0.13% 0.07% NA
Aus  269 36.80% 63.20% 0.00% 0.00% NA
Indica I  595 94.30% 5.00% 0.00% 0.67% NA
Indica II  465 75.70% 23.40% 0.00% 0.86% NA
Indica III  913 77.70% 22.20% 0.11% 0.00% NA
Indica Intermediate  786 79.00% 20.40% 0.13% 0.51% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 99.60% 0.20% 0.20% NA
Japonica Intermediate  241 0.40% 99.20% 0.41% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 33.30% 63.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304835233 G -> A LOC_Os03g09260.1 upstream_gene_variant ; 909.0bp to feature; MODIFIER silent_mutation Average:92.923; most accessible tissue: Minghui63 panicle, score: 97.329 N N N N
vg0304835233 G -> A LOC_Os03g09250-LOC_Os03g09260 intergenic_region ; MODIFIER silent_mutation Average:92.923; most accessible tissue: Minghui63 panicle, score: 97.329 N N N N
vg0304835233 G -> DEL N N silent_mutation Average:92.923; most accessible tissue: Minghui63 panicle, score: 97.329 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304835233 G A -0.02 -0.01 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304835233 NA 7.64E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 9.36E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 1.15E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 4.46E-45 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 5.18E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 3.44E-06 NA mr1083_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 2.02E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 3.27E-18 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 1.57E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 3.26E-06 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 2.46E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 3.53E-39 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 3.34E-44 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 6.49E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 7.56E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 1.76E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 1.04E-47 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 8.59E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 3.66E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 2.08E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304835233 NA 9.54E-36 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251