Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304830712:

Variant ID: vg0304830712 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4830712
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CCTAGTCTAGCCTTCAATTCTATTTTGGAAGAGACCTCTAGGCCTTGTTTAGTTGGAGAATAATTTTGGGTTTGGTTGTCACATCGGATATACGGATACA[C/T]
ATTTGAAGTATTAACCACAATCTAATAACAAAATAAATTACAGATTCCGCCAGGAAATTGCGATACGAATTTATTAAACCTAATTAATCCGTCATTAGTA

Reverse complement sequence

TACTAATGACGGATTAATTAGGTTTAATAAATTCGTATCGCAATTTCCTGGCGGAATCTGTAATTTATTTTGTTATTAGATTGTGGTTAATACTTCAAAT[G/A]
TGTATCCGTATATCCGATGTGACAACCAAACCCAAAATTATTCTCCAACTAAACAAGGCCTAGAGGTCTCTTCCAAAATAGAATTGAAGGCTAGACTAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.30%	40.30%	0.13%	0.30%	NA
All Indica	2759	90.10%	9.50%	0.00%	0.43%	NA
All Japonica	1512	0.30%	99.50%	0.13%	0.07%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	94.80%	4.50%	0.00%	0.67%	NA
Indica II	465	89.50%	9.70%	0.00%	0.86%	NA
Indica III	913	88.80%	11.20%	0.00%	0.00%	NA
Indica Intermediate	786	88.30%	11.20%	0.00%	0.51%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.20%	0.20%	0.20%	NA
Japonica Intermediate	241	0.40%	99.20%	0.41%	0.00%	NA
VI/Aromatic	96	18.80%	80.20%	1.04%	0.00%	NA
Intermediate	90	41.10%	54.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304830712	C -> T	LOC_Os03g09250.1	upstream_gene_variant ; 965.0bp to feature; MODIFIER	silent_mutation	Average:43.183; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0304830712	C -> T	LOC_Os03g09250.2	upstream_gene_variant ; 965.0bp to feature; MODIFIER	silent_mutation	Average:43.183; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0304830712	C -> T	LOC_Os03g09250.3	upstream_gene_variant ; 965.0bp to feature; MODIFIER	silent_mutation	Average:43.183; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0304830712	C -> T	LOC_Os03g09250.4	upstream_gene_variant ; 965.0bp to feature; MODIFIER	silent_mutation	Average:43.183; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0304830712	C -> T	LOC_Os03g09250-LOC_Os03g09260	intergenic_region ; MODIFIER	silent_mutation	Average:43.183; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0304830712	C -> DEL	N	N	silent_mutation	Average:43.183; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304830712	NA	8.77E-29	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	5.62E-31	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	3.59E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	3.88E-44	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	3.20E-31	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	6.26E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	2.53E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.22E-39	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	2.86E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.06E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.38E-35	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.49E-90	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	2.63E-53	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.15E-60	mr1861	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	2.12E-76	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	3.20E-62	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	7.37E-39	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	6.40E-38	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	6.93E-35	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	7.06E-32	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.08E-67	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.19E-36	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.88E-54	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.17E-41	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.77E-38	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	3.97E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.27E-39	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.60E-64	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	4.69E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	2.80E-45	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.09E-94	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	2.51E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.45E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	5.03E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.54E-29	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.45E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.55E-76	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	5.62E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	3.06E-91	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.87E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.12E-47	mr1861_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	1.21E-93	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304830712	NA	6.12E-36	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251