\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304795782:

Variant ID: vg0304795782 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4795782
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTCTTTCTTTTTTTCCCATCCATATGCTTCCCTTCCTTTATTACTATATCATGCGTCTTCATGAGACGATTTAATCAAAAGAATTTTTAGTATCTT[G/A]
CACTCGCATTTTTAATTTGTGACCATACTACACGGTATGTATATACATGTACTGTATGATAATTAACTAGCAATAGTTTCTTATTTACTCGAGAAAAAAA

Reverse complement sequence

TTTTTTTCTCGAGTAAATAAGAAACTATTGCTAGTTAATTATCATACAGTACATGTATATACATACCGTGTAGTATGGTCACAAATTAAAAATGCGAGTG[C/T]
AAGATACTAAAAATTCTTTTGATTAAATCGTCTCATGAAGACGCATGATATAGTAATAAAGGAAGGGAAGCATATGGATGGGAAAAAAAGAAAGAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.90% 3.40% 14.77% 45.96% NA
All Indica  2759 3.20% 5.20% 20.70% 70.93% NA
All Japonica  1512 99.50% 0.00% 0.20% 0.26% NA
Aus  269 3.00% 4.10% 38.66% 54.28% NA
Indica I  595 2.40% 3.40% 13.95% 80.34% NA
Indica II  465 9.50% 4.70% 22.80% 63.01% NA
Indica III  913 0.50% 8.30% 21.91% 69.22% NA
Indica Intermediate  786 3.20% 3.20% 23.16% 70.48% NA
Temperate Japonica  767 99.50% 0.00% 0.13% 0.39% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 52.10% 3.10% 9.38% 35.42% NA
Intermediate  90 51.10% 2.20% 12.22% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304795782 G -> A LOC_Os03g09190.1 downstream_gene_variant ; 2636.0bp to feature; MODIFIER silent_mutation Average:10.662; most accessible tissue: Callus, score: 42.907 N N N N
vg0304795782 G -> A LOC_Os03g09190.2 downstream_gene_variant ; 2636.0bp to feature; MODIFIER silent_mutation Average:10.662; most accessible tissue: Callus, score: 42.907 N N N N
vg0304795782 G -> A LOC_Os03g09200.1 intron_variant ; MODIFIER silent_mutation Average:10.662; most accessible tissue: Callus, score: 42.907 N N N N
vg0304795782 G -> DEL N N silent_mutation Average:10.662; most accessible tissue: Callus, score: 42.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304795782 NA 3.49E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304795782 8.64E-06 NA mr1265 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304795782 NA 1.39E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304795782 NA 5.14E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251