Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0304762695:

Variant ID: vg0304762695 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4762695
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

TGGATGGCCAGCAGGAGGAGCAGCACGCGGGGCGGCGGCAGCTGGAGCCCGGGAAAGACGAAAATATCCCTATGCAAATAATTTTTTATGGACAAAAATA[T/C]
CCCTCTACAATTCTACTATCATTAAGTGTGATGGTAGTAGAAATAGATCTGAACCCTATGATCAAATGAGATCAACGGTTCAGATTATTTTCTACTACAA

Reverse complement sequence

TTGTAGTAGAAAATAATCTGAACCGTTGATCTCATTTGATCATAGGGTTCAGATCTATTTCTACTACCATCACACTTAATGATAGTAGAATTGTAGAGGG[A/G]
TATTTTTGTCCATAAAAAATTATTTGCATAGGGATATTTTCGTCTTTCCCGGGCTCCAGCTGCCGCCGCCCCGCGTGCTGCTCCTCCTGCTGGCCATCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	12.70%	10.58%	24.71%	NA
All Indica	2759	23.20%	21.40%	15.37%	40.01%	NA
All Japonica	1512	97.20%	0.20%	0.40%	2.18%	NA
Aus	269	79.90%	0.00%	14.13%	5.95%	NA
Indica I	595	5.00%	9.40%	13.45%	72.10%	NA
Indica II	465	57.40%	4.10%	22.37%	16.13%	NA
Indica III	913	15.40%	43.60%	11.28%	29.68%	NA
Indica Intermediate	786	25.70%	15.00%	17.43%	41.86%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	92.70%	0.40%	0.40%	6.55%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	78.10%	0.00%	19.79%	2.08%	NA
Intermediate	90	65.60%	5.60%	14.44%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304762695	T -> C	LOC_Os03g09140.1	upstream_gene_variant ; 1061.0bp to feature; MODIFIER	silent_mutation	Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg0304762695	T -> C	LOC_Os03g09140.2	upstream_gene_variant ; 1061.0bp to feature; MODIFIER	silent_mutation	Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg0304762695	T -> C	LOC_Os03g09130.1	intron_variant ; MODIFIER	silent_mutation	Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N
vg0304762695	T -> DEL	N	N	silent_mutation	Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304762695	7.92E-06	1.39E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	NA	2.71E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	1.01E-07	4.35E-07	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	2.67E-07	8.35E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	1.34E-08	1.48E-07	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	2.61E-08	6.49E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	3.04E-10	2.85E-08	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695	3.06E-10	3.45E-08	mr1389_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251