\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304762695:

Variant ID: vg0304762695 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4762695
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TGGATGGCCAGCAGGAGGAGCAGCACGCGGGGCGGCGGCAGCTGGAGCCCGGGAAAGACGAAAATATCCCTATGCAAATAATTTTTTATGGACAAAAATA[T/C]
CCCTCTACAATTCTACTATCATTAAGTGTGATGGTAGTAGAAATAGATCTGAACCCTATGATCAAATGAGATCAACGGTTCAGATTATTTTCTACTACAA

Reverse complement sequence

TTGTAGTAGAAAATAATCTGAACCGTTGATCTCATTTGATCATAGGGTTCAGATCTATTTCTACTACCATCACACTTAATGATAGTAGAATTGTAGAGGG[A/G]
TATTTTTGTCCATAAAAAATTATTTGCATAGGGATATTTTCGTCTTTCCCGGGCTCCAGCTGCCGCCGCCCCGCGTGCTGCTCCTCCTGCTGGCCATCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 12.70% 10.58% 24.71% NA
All Indica  2759 23.20% 21.40% 15.37% 40.01% NA
All Japonica  1512 97.20% 0.20% 0.40% 2.18% NA
Aus  269 79.90% 0.00% 14.13% 5.95% NA
Indica I  595 5.00% 9.40% 13.45% 72.10% NA
Indica II  465 57.40% 4.10% 22.37% 16.13% NA
Indica III  913 15.40% 43.60% 11.28% 29.68% NA
Indica Intermediate  786 25.70% 15.00% 17.43% 41.86% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 92.70% 0.40% 0.40% 6.55% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 78.10% 0.00% 19.79% 2.08% NA
Intermediate  90 65.60% 5.60% 14.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304762695 T -> C LOC_Os03g09140.1 upstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg0304762695 T -> C LOC_Os03g09140.2 upstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg0304762695 T -> C LOC_Os03g09130.1 intron_variant ; MODIFIER silent_mutation Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N
vg0304762695 T -> DEL N N silent_mutation Average:64.427; most accessible tissue: Zhenshan97 flower, score: 87.237 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304762695 7.92E-06 1.39E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 NA 2.71E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 1.01E-07 4.35E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 2.67E-07 8.35E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 1.34E-08 1.48E-07 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 2.61E-08 6.49E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 3.04E-10 2.85E-08 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304762695 3.06E-10 3.45E-08 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251