Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304752256:

Variant ID: vg0304752256 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4752256
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TAATCCTATAAAAAAATTTCCTAAGAAGCCCTTTGAAATAAAGGATTGAATCCTATCCAATCCTTTGAAATTTCTATGGAATGGACAATCCTATACATAT[T/G,A]
TTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGTTAACTTTCTTTTGAGTATATGTCTCTCATCCAATTACTGTGTTTTTCCTACGGTTCAATCAAATG

Reverse complement sequence

CATTTGATTGAACCGTAGGAAAAACACAGTAATTGGATGAGAGACATATACTCAAAAGAAAGTTAACAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAA[A/C,T]
ATATGTATAGGATTGTCCATTCCATAGAAATTTCAAAGGATTGGATAGGATTCAATCCTTTATTTCAAAGGGCTTCTTAGGAAATTTTTTTATAGGATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	45.40%	0.17%	0.00%	A: 0.02%
All Indica	2759	79.10%	20.70%	0.22%	0.00%	A: 0.04%
All Japonica	1512	2.70%	97.30%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	94.60%	5.00%	0.17%	0.00%	A: 0.17%
Indica II	465	83.90%	15.30%	0.86%	0.00%	NA
Indica III	913	69.00%	31.00%	0.00%	0.00%	NA
Indica Intermediate	786	76.20%	23.70%	0.13%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	7.30%	92.70%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	40.00%	57.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304752256	T -> A	LOC_Os03g09120.1	upstream_gene_variant ; 2003.0bp to feature; MODIFIER	silent_mutation	Average:28.437; most accessible tissue: Callus, score: 68.759	N	N	N	N
vg0304752256	T -> A	LOC_Os03g09120-LOC_Os03g09130	intergenic_region ; MODIFIER	silent_mutation	Average:28.437; most accessible tissue: Callus, score: 68.759	N	N	N	N
vg0304752256	T -> G	LOC_Os03g09120.1	upstream_gene_variant ; 2003.0bp to feature; MODIFIER	silent_mutation	Average:28.437; most accessible tissue: Callus, score: 68.759	N	N	N	N
vg0304752256	T -> G	LOC_Os03g09120-LOC_Os03g09130	intergenic_region ; MODIFIER	silent_mutation	Average:28.437; most accessible tissue: Callus, score: 68.759	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304752256	NA	1.07E-26	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	6.32E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	2.79E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	7.59E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	2.25E-07	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	2.15E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	1.09E-23	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	1.11E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	2.19E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	4.31E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	5.36E-06	4.34E-35	mr1733	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	1.43E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	9.57E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	2.88E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	7.29E-17	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	1.08E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	3.14E-44	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752256	NA	3.74E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251