\
| Variant ID: vg0304752239 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 4752239 |
| Reference Allele: G | Alternative Allele: A,GA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTTTTAGAGAATTTTAATCCTATAAAAAAATTTCCTAAGAAGCCCTTTGAAATAAAGGATTGAATCCTATCCAATCCTTTGAAATTTCTATGGAATG[G/A,GA]
ACAATCCTATACATATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGTTAACTTTCTTTTGAGTATATGTCTCTCATCCAATTACTGTGTTTTTCC
GGAAAAACACAGTAATTGGATGAGAGACATATACTCAAAAGAAAGTTAACAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAAAATATGTATAGGATTGT[C/T,TC]
CATTCCATAGAAATTTCAAAGGATTGGATAGGATTCAATCCTTTATTTCAAAGGGCTTCTTAGGAAATTTTTTTATAGGATTAAAATTCTCTAAAAATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.60% | 0.15% | 0.00% | GA: 0.02% |
| All Indica | 2759 | 28.30% | 71.50% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 38.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 5.00% | 94.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 29.70% | 69.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 39.10% | 60.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 32.40% | 67.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 0.00% | 0.00% | GA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304752239 | G -> GA | LOC_Os03g09120.1 | upstream_gene_variant ; 1987.0bp to feature; MODIFIER | silent_mutation | Average:28.898; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| vg0304752239 | G -> GA | LOC_Os03g09120-LOC_Os03g09130 | intergenic_region ; MODIFIER | silent_mutation | Average:28.898; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| vg0304752239 | G -> A | LOC_Os03g09120.1 | upstream_gene_variant ; 1986.0bp to feature; MODIFIER | silent_mutation | Average:28.898; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| vg0304752239 | G -> A | LOC_Os03g09120-LOC_Os03g09130 | intergenic_region ; MODIFIER | silent_mutation | Average:28.898; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304752239 | NA | 8.87E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | NA | 3.22E-12 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | 4.00E-06 | 3.13E-06 | mr1733 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | NA | 1.28E-06 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | NA | 7.22E-06 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | 4.62E-06 | 9.90E-19 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | NA | 8.03E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | NA | 7.36E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752239 | NA | 9.89E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |