\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304752239:

Variant ID: vg0304752239 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 4752239
Reference Allele: GAlternative Allele: A,GA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTTTTAGAGAATTTTAATCCTATAAAAAAATTTCCTAAGAAGCCCTTTGAAATAAAGGATTGAATCCTATCCAATCCTTTGAAATTTCTATGGAATG[G/A,GA]
ACAATCCTATACATATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGTTAACTTTCTTTTGAGTATATGTCTCTCATCCAATTACTGTGTTTTTCC

Reverse complement sequence

GGAAAAACACAGTAATTGGATGAGAGACATATACTCAAAAGAAAGTTAACAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAAAATATGTATAGGATTGT[C/T,TC]
CATTCCATAGAAATTTCAAAGGATTGGATAGGATTCAATCCTTTATTTCAAAGGGCTTCTTAGGAAATTTTTTTATAGGATTAAAATTCTCTAAAAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.60% 0.15% 0.00% GA: 0.02%
All Indica  2759 28.30% 71.50% 0.25% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 5.00% 94.80% 0.17% 0.00% NA
Indica II  465 29.70% 69.50% 0.86% 0.00% NA
Indica III  913 39.10% 60.90% 0.00% 0.00% NA
Indica Intermediate  786 32.40% 67.30% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 92.70% 7.30% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 0.00% 0.00% GA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304752239 G -> GA LOC_Os03g09120.1 upstream_gene_variant ; 1987.0bp to feature; MODIFIER silent_mutation Average:28.898; most accessible tissue: Callus, score: 68.759 N N N N
vg0304752239 G -> GA LOC_Os03g09120-LOC_Os03g09130 intergenic_region ; MODIFIER silent_mutation Average:28.898; most accessible tissue: Callus, score: 68.759 N N N N
vg0304752239 G -> A LOC_Os03g09120.1 upstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:28.898; most accessible tissue: Callus, score: 68.759 N N N N
vg0304752239 G -> A LOC_Os03g09120-LOC_Os03g09130 intergenic_region ; MODIFIER silent_mutation Average:28.898; most accessible tissue: Callus, score: 68.759 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304752239 NA 8.87E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 NA 3.22E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 4.00E-06 3.13E-06 mr1733 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 NA 1.28E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 NA 7.22E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 4.62E-06 9.90E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 NA 8.03E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 NA 7.36E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752239 NA 9.89E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251