\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304752208:

Variant ID: vg0304752208 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4752208
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTAGGCCCATTTGATTCGGAGGAAAAACATAATTTTTAGAGAATTTTAATCCTATAAAAAAATTTCCTAAGAAGCCCTTTGAAATAAAGGATTGAATC[C/A]
TATCCAATCCTTTGAAATTTCTATGGAATGGACAATCCTATACATATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGTTAACTTTCTTTTGAGTA

Reverse complement sequence

TACTCAAAAGAAAGTTAACAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAAAATATGTATAGGATTGTCCATTCCATAGAAATTTCAAAGGATTGGATA[G/T]
GATTCAATCCTTTATTTCAAAGGGCTTCTTAGGAAATTTTTTTATAGGATTAAAATTCTCTAAAAATTATGTTTTTCCTCCGAATCAAATGGGCCTAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.60% 0.17% 0.13% NA
All Indica  2759 24.50% 75.20% 0.11% 0.18% NA
All Japonica  1512 95.00% 4.70% 0.20% 0.07% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 2.70% 97.10% 0.00% 0.17% NA
Indica II  465 27.10% 72.30% 0.22% 0.43% NA
Indica III  913 38.20% 61.80% 0.00% 0.00% NA
Indica Intermediate  786 23.70% 75.80% 0.25% 0.25% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 92.30% 7.10% 0.40% 0.20% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304752208 C -> A LOC_Os03g09120.1 upstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:36.708; most accessible tissue: Callus, score: 68.759 N N N N
vg0304752208 C -> A LOC_Os03g09120-LOC_Os03g09130 intergenic_region ; MODIFIER silent_mutation Average:36.708; most accessible tissue: Callus, score: 68.759 N N N N
vg0304752208 C -> DEL N N silent_mutation Average:36.708; most accessible tissue: Callus, score: 68.759 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304752208 NA 3.20E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 2.54E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 5.66E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 3.55E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 3.41E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 2.84E-07 2.60E-20 mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 1.02E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 2.20E-08 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 1.21E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208 NA 7.87E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251