Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0304752208:

Variant ID: vg0304752208 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4752208
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTAGGCCCATTTGATTCGGAGGAAAAACATAATTTTTAGAGAATTTTAATCCTATAAAAAAATTTCCTAAGAAGCCCTTTGAAATAAAGGATTGAATC[C/A]
TATCCAATCCTTTGAAATTTCTATGGAATGGACAATCCTATACATATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGTTAACTTTCTTTTGAGTA

Reverse complement sequence

TACTCAAAAGAAAGTTAACAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAAAATATGTATAGGATTGTCCATTCCATAGAAATTTCAAAGGATTGGATA[G/T]
GATTCAATCCTTTATTTCAAAGGGCTTCTTAGGAAATTTTTTTATAGGATTAAAATTCTCTAAAAATTATGTTTTTCCTCCGAATCAAATGGGCCTAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	48.60%	0.17%	0.13%	NA
All Indica	2759	24.50%	75.20%	0.11%	0.18%	NA
All Japonica	1512	95.00%	4.70%	0.20%	0.07%	NA
Aus	269	61.70%	38.30%	0.00%	0.00%	NA
Indica I	595	2.70%	97.10%	0.00%	0.17%	NA
Indica II	465	27.10%	72.30%	0.22%	0.43%	NA
Indica III	913	38.20%	61.80%	0.00%	0.00%	NA
Indica Intermediate	786	23.70%	75.80%	0.25%	0.25%	NA
Temperate Japonica	767	95.60%	4.40%	0.00%	0.00%	NA
Tropical Japonica	504	92.30%	7.10%	0.40%	0.20%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	63.30%	34.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304752208	C -> A	LOC_Os03g09120.1	upstream_gene_variant ; 1955.0bp to feature; MODIFIER	silent_mutation	Average:36.708; most accessible tissue: Callus, score: 68.759	N	N	N	N
vg0304752208	C -> A	LOC_Os03g09120-LOC_Os03g09130	intergenic_region ; MODIFIER	silent_mutation	Average:36.708; most accessible tissue: Callus, score: 68.759	N	N	N	N
vg0304752208	C -> DEL	N	N	silent_mutation	Average:36.708; most accessible tissue: Callus, score: 68.759	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304752208	NA	3.20E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	2.54E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	5.66E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	3.55E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	3.41E-06	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	2.84E-07	2.60E-20	mr1531_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	1.02E-08	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	2.20E-08	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	1.21E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304752208	NA	7.87E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251