\
| Variant ID: vg0304752208 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4752208 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 90. )
CTTTAGGCCCATTTGATTCGGAGGAAAAACATAATTTTTAGAGAATTTTAATCCTATAAAAAAATTTCCTAAGAAGCCCTTTGAAATAAAGGATTGAATC[C/A]
TATCCAATCCTTTGAAATTTCTATGGAATGGACAATCCTATACATATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGTTAACTTTCTTTTGAGTA
TACTCAAAAGAAAGTTAACAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAAAATATGTATAGGATTGTCCATTCCATAGAAATTTCAAAGGATTGGATA[G/T]
GATTCAATCCTTTATTTCAAAGGGCTTCTTAGGAAATTTTTTTATAGGATTAAAATTCTCTAAAAATTATGTTTTTCCTCCGAATCAAATGGGCCTAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 48.60% | 0.17% | 0.13% | NA |
| All Indica | 2759 | 24.50% | 75.20% | 0.11% | 0.18% | NA |
| All Japonica | 1512 | 95.00% | 4.70% | 0.20% | 0.07% | NA |
| Aus | 269 | 61.70% | 38.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 2.70% | 97.10% | 0.00% | 0.17% | NA |
| Indica II | 465 | 27.10% | 72.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 38.20% | 61.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 23.70% | 75.80% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 7.10% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304752208 | C -> A | LOC_Os03g09120.1 | upstream_gene_variant ; 1955.0bp to feature; MODIFIER | silent_mutation | Average:36.708; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| vg0304752208 | C -> A | LOC_Os03g09120-LOC_Os03g09130 | intergenic_region ; MODIFIER | silent_mutation | Average:36.708; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| vg0304752208 | C -> DEL | N | N | silent_mutation | Average:36.708; most accessible tissue: Callus, score: 68.759 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304752208 | NA | 3.20E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 2.54E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 5.66E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 3.55E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 3.41E-06 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | 2.84E-07 | 2.60E-20 | mr1531_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 1.02E-08 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 2.20E-08 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 1.21E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304752208 | NA | 7.87E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |