\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304679171:

Variant ID: vg0304679171 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4679171
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACAAGTTTTCAGAGCAAAAGGCTCACACGTTTTCAGAGCAAAAGGCTGTGGCCTGCTTTAGTTCCCTAAATTTATTTTACAAAAACATCACATCGAAT[C/A]
TTTAACACATGCATAGAGAATTAAATATAAATTAAAAAAATAATTTCACAATTATGGAGGAAATCGTGAGACGAATCTTTTAAGCATAATTAGTCCATGA

Reverse complement sequence

TCATGGACTAATTATGCTTAAAAGATTCGTCTCACGATTTCCTCCATAATTGTGAAATTATTTTTTTAATTTATATTTAATTCTCTATGCATGTGTTAAA[G/T]
ATTCGATGTGATGTTTTTGTAAAATAAATTTAGGGAACTAAAGCAGGCCACAGCCTTTTGCTCTGAAAACGTGTGAGCCTTTTGCTCTGAAAACTTGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 14.10% 0.06% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 58.00% 41.90% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 80.30% 19.60% 0.13% 0.00% NA
Tropical Japonica  504 16.70% 83.30% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304679171 C -> A LOC_Os03g09020.1 downstream_gene_variant ; 3514.0bp to feature; MODIFIER silent_mutation Average:94.44; most accessible tissue: Minghui63 young leaf, score: 98.811 N N N N
vg0304679171 C -> A LOC_Os03g08999-LOC_Os03g09020 intergenic_region ; MODIFIER silent_mutation Average:94.44; most accessible tissue: Minghui63 young leaf, score: 98.811 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304679171 C A 0.03 0.02 0.05 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304679171 NA 1.99E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 8.83E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 7.48E-13 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 6.22E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 5.02E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 2.95E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 5.05E-06 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 7.84E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 5.63E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 5.53E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 6.24E-09 mr1574_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304679171 NA 6.30E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251