RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0304670640:

Variant ID: vg0304670640 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4670640
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TATTATTCTCAAGTAATGCACTATTCTAAAATAAGGTATACACCATTATATTATGTACCCATTAAATTAACAATTTAAAATCTATATTAACTAATTTACA[C/A]
TTACACTAGAACTGGTGGACCTATTATTATAATCATCAAATCTATTGTTTGCTAATAAATAAAGCGTCCAAAATTCTCTTTTTGCCCGCTGCACATTGCA

Reverse complement sequence

TGCAATGTGCAGCGGGCAAAAAGAGAATTTTGGACGCTTTATTTATTAGCAAACAATAGATTTGATGATTATAATAATAGGTCCACCAGTTCTAGTGTAA[G/T]
TGTAAATTAGTTAATATAGATTTTAAATTGTTAATTTAATGGGTACATAATATAATGGTGTATACCTTATTTTAGAATAGTGCATTACTTGAGAATAATA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.40%	0.17%	0.00%	NA
All Indica	2759	21.80%	78.00%	0.14%	0.00%	NA
All Japonica	1512	97.40%	2.40%	0.20%	0.00%	NA
Aus	269	59.50%	40.50%	0.00%	0.00%	NA
Indica I	595	2.50%	97.50%	0.00%	0.00%	NA
Indica II	465	26.50%	73.50%	0.00%	0.00%	NA
Indica III	913	29.10%	70.80%	0.11%	0.00%	NA
Indica Intermediate	786	25.20%	74.40%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	92.70%	6.90%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304670640	C -> A	LOC_Os03g08980.1	upstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:37.002; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0304670640	C -> A	LOC_Os03g08999.1	upstream_gene_variant ; 1723.0bp to feature; MODIFIER	silent_mutation	Average:37.002; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0304670640	C -> A	LOC_Os03g08999-LOC_Os03g09020	intergenic_region ; MODIFIER	silent_mutation	Average:37.002; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304670640	NA	1.79E-16	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304670640	NA	6.87E-20	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304670640	NA	7.77E-10	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304670640	NA	8.56E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304670640	NA	2.36E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304670640	NA	3.86E-08	mr1807_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0304670640:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact