Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0304531065:

Variant ID: vg0304531065 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4531065
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTAAACTCACCTAATTTTAGGGGTGGTAAATTGTGACCTGGTAACCAAGCACCCACCTGTTATATAGCAGGCCAAATGGGTGGCTTAACCTAACAC[G/A]
CCACATCACCTATATCGGACCGTGCCATGTCGGCCCACATGTCAAGACCACAGTCTAAGGTGGTGCCGTATCGTGCTAGGGCGACGCGGTTACTGTTACA

Reverse complement sequence

TGTAACAGTAACCGCGTCGCCCTAGCACGATACGGCACCACCTTAGACTGTGGTCTTGACATGTGGGCCGACATGGCACGGTCCGATATAGGTGATGTGG[C/T]
GTGTTAGGTTAAGCCACCCATTTGGCCTGCTATATAACAGGTGGGTGCTTGGTTACCAGGTCACAATTTACCACCCCTAAAATTAGGTGAGTTTAATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.20% 0.02% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 70.00% 30.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 90.40% 9.60% 0.00% 0.00% NA
Tropical Japonica  504 30.40% 69.60% 0.00% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304531065 G -> A LOC_Os03g08770.1 upstream_gene_variant ; 1821.0bp to feature; MODIFIER silent_mutation Average:79.578; most accessible tissue: Zhenshan97 root, score: 95.642 N N N N
vg0304531065 G -> A LOC_Os03g08770.2 upstream_gene_variant ; 1821.0bp to feature; MODIFIER silent_mutation Average:79.578; most accessible tissue: Zhenshan97 root, score: 95.642 N N N N
vg0304531065 G -> A LOC_Os03g08754-LOC_Os03g08770 intergenic_region ; MODIFIER silent_mutation Average:79.578; most accessible tissue: Zhenshan97 root, score: 95.642 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304531065 G A -0.09 -0.09 -0.07 -0.04 -0.08 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304531065 NA 6.23E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 1.12E-06 NA mr1471 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 5.08E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 1.87E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 4.07E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 1.84E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 1.76E-06 1.51E-10 mr1642 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 1.81E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 4.68E-08 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 5.75E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 7.22E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 4.68E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 7.21E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 4.10E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 1.18E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 2.23E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 2.63E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 3.30E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304531065 NA 1.06E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251