Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304467395:

Variant ID: vg0304467395 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 4467395
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CCCCCGACCCGAACTATCGCGCTTGACCGAATTACCTTCTTGAACCCGAAAACCATGCATTGCTCACCCTGAACTTTCAATACCGGATGAATTACCAATC[T/C]
AGAGCGGTTTTATCCTACGTGGCATACGCGTGGCAGTCCAGTCAGCATTTTTTTTAAAAAATGGTGGGGTCCACCTGTCATGCCTCCACTTCACCTCTTC

Reverse complement sequence

GAAGAGGTGAAGTGGAGGCATGACAGGTGGACCCCACCATTTTTTAAAAAAAATGCTGACTGGACTGCCACGCGTATGCCACGTAGGATAAAACCGCTCT[A/G]
GATTGGTAATTCATCCGGTATTGAAAGTTCAGGGTGAGCAATGCATGGTTTTCGGGTTCAAGAAGGTAATTCGGTCAAGCGCGATAGTTCGGGTCGGGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.00%	24.00%	0.04%	0.00%	NA
All Indica	2759	97.10%	2.90%	0.04%	0.00%	NA
All Japonica	1512	37.40%	62.60%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.90%	7.10%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.20%	0.13%	0.00%	NA
Temperate Japonica	767	11.90%	88.10%	0.00%	0.00%	NA
Tropical Japonica	504	78.20%	21.80%	0.00%	0.00%	NA
Japonica Intermediate	241	33.20%	66.80%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	77.10%	1.04%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0304467395	T -> C	LOC_Os03g08670.1	upstream_gene_variant ; 234.0bp to feature; MODIFIER	silent_mutation	Average:69.814; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0304467395	T -> C	LOC_Os03g08660.1	downstream_gene_variant ; 2300.0bp to feature; MODIFIER	silent_mutation	Average:69.814; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0304467395	T -> C	LOC_Os03g08680.2	downstream_gene_variant ; 3170.0bp to feature; MODIFIER	silent_mutation	Average:69.814; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N
vg0304467395	T -> C	LOC_Os03g08660-LOC_Os03g08670	intergenic_region ; MODIFIER	silent_mutation	Average:69.814; most accessible tissue: Zhenshan97 flag leaf, score: 82.874	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0304467395	NA	4.98E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	7.27E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	4.98E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	5.62E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	7.02E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	8.19E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.59E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.90E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	5.40E-08	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.83E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	5.61E-06	2.09E-07	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	2.39E-07	2.39E-07	mr1621	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	3.15E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.31E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.29E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.62E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.53E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	4.00E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	2.68E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	6.97E-06	6.96E-06	mr1815	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	4.33E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.75E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.26E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.06E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	7.58E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	4.28E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	3.66E-07	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	4.86E-09	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	2.15E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	6.35E-08	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.41E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	3.16E-11	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	3.38E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.53E-12	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	2.86E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.51E-06	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	2.40E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	3.97E-15	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	2.65E-10	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.60E-19	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467395	NA	1.67E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251