\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304467332:

Variant ID: vg0304467332 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4467332
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGACCTATTAGACATGCTCTTATAGATAGCATAGTTAAAAGAAAAAAGTACGAATTACACCCCCCGACCCGAACTATCGCGCTTGACCGAATTACCT[T/C]
CTTGAACCCGAAAACCATGCATTGCTCACCCTGAACTTTCAATACCGGATGAATTACCAATCTAGAGCGGTTTTATCCTACGTGGCATACGCGTGGCAGT

Reverse complement sequence

ACTGCCACGCGTATGCCACGTAGGATAAAACCGCTCTAGATTGGTAATTCATCCGGTATTGAAAGTTCAGGGTGAGCAATGCATGGTTTTCGGGTTCAAG[A/G]
AGGTAATTCGGTCAAGCGCGATAGTTCGGGTCGGGGGGTGTAATTCGTACTTTTTTCTTTTAACTATGCTATCTATAAGAGCATGTCTAATAGGTCAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.00% 0.04% 0.00% NA
All Indica  2759 97.10% 2.90% 0.04% 0.00% NA
All Japonica  1512 37.30% 62.60% 0.07% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.30% 0.13% 0.00% NA
Temperate Japonica  767 11.90% 88.10% 0.00% 0.00% NA
Tropical Japonica  504 78.20% 21.80% 0.00% 0.00% NA
Japonica Intermediate  241 32.80% 66.80% 0.41% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304467332 T -> C LOC_Os03g08670.1 upstream_gene_variant ; 297.0bp to feature; MODIFIER silent_mutation Average:62.234; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0304467332 T -> C LOC_Os03g08660.1 downstream_gene_variant ; 2237.0bp to feature; MODIFIER silent_mutation Average:62.234; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0304467332 T -> C LOC_Os03g08680.2 downstream_gene_variant ; 3233.0bp to feature; MODIFIER silent_mutation Average:62.234; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0304467332 T -> C LOC_Os03g08660-LOC_Os03g08670 intergenic_region ; MODIFIER silent_mutation Average:62.234; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304467332 NA 5.82E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 3.96E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.23E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 7.44E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 2.14E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 7.62E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.15E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.86E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 4.57E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.14E-07 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.15E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 5.24E-06 2.53E-07 mr1482 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 1.13E-06 1.13E-06 mr1621 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 3.74E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.49E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.64E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.45E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.46E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.95E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 3.79E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 1.05E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.97E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 2.87E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 9.30E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 6.01E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.25E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 8.26E-08 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 6.62E-11 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 9.07E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 3.97E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 6.07E-15 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 2.31E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.60E-19 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304467332 NA 5.12E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251