\
| Variant ID: vg0304420874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4420874 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 113. )
TTGATAAACTTGTTTTCTCACTTCTTCGGTCATGTCTTTCCTTCCTTCGATGGTTTACTTCAACGAGAGCCATGACATGTTCTAGCAAAAGGAAGAAAAT[C/A]
AAGTTCATTGATAGTACAAATAGCCATGGCATGTTCTAGCAAAATCTAATTGTATCAAAAAGAAGTTGGCTTACCAGCAAGGTGTTGTACATAATCGAAA
TTTCGATTATGTACAACACCTTGCTGGTAAGCCAACTTCTTTTTGATACAATTAGATTTTGCTAGAACATGCCATGGCTATTTGTACTATCAATGAACTT[G/T]
ATTTTCTTCCTTTTGCTAGAACATGTCATGGCTCTCGTTGAAGTAAACCATCGAAGGAAGGAAAGACATGACCGAAGAAGTGAGAAAACAAGTTTATCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.60% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 22.80% | 76.70% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.30% | 87.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 13.10% | 86.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 31.00% | 68.50% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 27.10% | 72.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304420874 | C -> A | LOC_Os03g08590.1 | upstream_gene_variant ; 1492.0bp to feature; MODIFIER | silent_mutation | Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| vg0304420874 | C -> A | LOC_Os03g08580.1 | downstream_gene_variant ; 1757.0bp to feature; MODIFIER | silent_mutation | Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| vg0304420874 | C -> A | LOC_Os03g08580.3 | downstream_gene_variant ; 1757.0bp to feature; MODIFIER | silent_mutation | Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| vg0304420874 | C -> A | LOC_Os03g08580.2 | downstream_gene_variant ; 1757.0bp to feature; MODIFIER | silent_mutation | Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| vg0304420874 | C -> A | LOC_Os03g08590-LOC_Os03g08600 | intergenic_region ; MODIFIER | silent_mutation | Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304420874 | NA | 3.59E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304420874 | NA | 1.45E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304420874 | 7.22E-06 | 1.11E-07 | mr1400_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304420874 | NA | 6.07E-14 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304420874 | NA | 1.35E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |