\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304420874:

Variant ID: vg0304420874 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4420874
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATAAACTTGTTTTCTCACTTCTTCGGTCATGTCTTTCCTTCCTTCGATGGTTTACTTCAACGAGAGCCATGACATGTTCTAGCAAAAGGAAGAAAAT[C/A]
AAGTTCATTGATAGTACAAATAGCCATGGCATGTTCTAGCAAAATCTAATTGTATCAAAAAGAAGTTGGCTTACCAGCAAGGTGTTGTACATAATCGAAA

Reverse complement sequence

TTTCGATTATGTACAACACCTTGCTGGTAAGCCAACTTCTTTTTGATACAATTAGATTTTGCTAGAACATGCCATGGCTATTTGTACTATCAATGAACTT[G/T]
ATTTTCTTCCTTTTGCTAGAACATGTCATGGCTCTCGTTGAAGTAAACCATCGAAGGAAGGAAAGACATGACCGAAGAAGTGAGAAAACAAGTTTATCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.60% 0.25% 0.00% NA
All Indica  2759 22.80% 76.70% 0.43% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 12.30% 87.60% 0.17% 0.00% NA
Indica II  465 13.10% 86.90% 0.00% 0.00% NA
Indica III  913 31.00% 68.50% 0.55% 0.00% NA
Indica Intermediate  786 27.10% 72.10% 0.76% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304420874 C -> A LOC_Os03g08590.1 upstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg0304420874 C -> A LOC_Os03g08580.1 downstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg0304420874 C -> A LOC_Os03g08580.3 downstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg0304420874 C -> A LOC_Os03g08580.2 downstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg0304420874 C -> A LOC_Os03g08590-LOC_Os03g08600 intergenic_region ; MODIFIER silent_mutation Average:19.981; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304420874 NA 3.59E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874 NA 1.45E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874 7.22E-06 1.11E-07 mr1400_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874 NA 6.07E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304420874 NA 1.35E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251