\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304417215:

Variant ID: vg0304417215 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4417215
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, T: 0.23, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATTGAGAAGAATCAAATGGGTGATGTGTCAGTCAATCGACCGATCAAGGCGGAGCCAGCTGCAGGCGGCATTGCTCAGGTATTAGAACAGAAAGTTT[T/A]
TTCTTTTTACCATCGTGTTTGTTCTTAATTTCAGGTAGCAATTGTTGGGCTCATGATTCTGTCATACAGAATGCATGCTTCCTTGAATTATTGCCATTAG

Reverse complement sequence

CTAATGGCAATAATTCAAGGAAGCATGCATTCTGTATGACAGAATCATGAGCCCAACAATTGCTACCTGAAATTAAGAACAAACACGATGGTAAAAAGAA[A/T]
AAACTTTCTGTTCTAATACCTGAGCAATGCCGCCTGCAGCTGGCTCCGCCTTGATCGGTCGATTGACTGACACATCACCCATTTGATTCTTCTCAATGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 20.80% 0.06% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 41.70% 58.30% 0.07% 0.00% NA
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 17.30% 82.50% 0.13% 0.00% NA
Tropical Japonica  504 80.80% 19.20% 0.00% 0.00% NA
Japonica Intermediate  241 37.30% 62.70% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304417215 T -> A LOC_Os03g08570.1 downstream_gene_variant ; 2412.0bp to feature; MODIFIER silent_mutation Average:55.067; most accessible tissue: Callus, score: 86.995 N N N N
vg0304417215 T -> A LOC_Os03g08590.1 downstream_gene_variant ; 1858.0bp to feature; MODIFIER silent_mutation Average:55.067; most accessible tissue: Callus, score: 86.995 N N N N
vg0304417215 T -> A LOC_Os03g08580.1 intron_variant ; MODIFIER silent_mutation Average:55.067; most accessible tissue: Callus, score: 86.995 N N N N
vg0304417215 T -> A LOC_Os03g08580.3 intron_variant ; MODIFIER silent_mutation Average:55.067; most accessible tissue: Callus, score: 86.995 N N N N
vg0304417215 T -> A LOC_Os03g08580.2 intron_variant ; MODIFIER silent_mutation Average:55.067; most accessible tissue: Callus, score: 86.995 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304417215 NA 5.86E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 7.52E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 4.89E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 9.21E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 2.13E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 9.00E-06 NA mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 4.52E-09 mr1671 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 6.68E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 2.65E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 8.16E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 7.43E-06 NA mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 4.83E-10 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304417215 NA 6.80E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251