\
| Variant ID: vg0304417215 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4417215 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, T: 0.23, others allele: 0.00, population size: 227. )
TTCATTGAGAAGAATCAAATGGGTGATGTGTCAGTCAATCGACCGATCAAGGCGGAGCCAGCTGCAGGCGGCATTGCTCAGGTATTAGAACAGAAAGTTT[T/A]
TTCTTTTTACCATCGTGTTTGTTCTTAATTTCAGGTAGCAATTGTTGGGCTCATGATTCTGTCATACAGAATGCATGCTTCCTTGAATTATTGCCATTAG
CTAATGGCAATAATTCAAGGAAGCATGCATTCTGTATGACAGAATCATGAGCCCAACAATTGCTACCTGAAATTAAGAACAAACACGATGGTAAAAAGAA[A/T]
AAACTTTCTGTTCTAATACCTGAGCAATGCCGCCTGCAGCTGGCTCCGCCTTGATCGGTCGATTGACTGACACATCACCCATTTGATTCTTCTCAATGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 20.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 41.70% | 58.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 17.30% | 82.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 37.30% | 62.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304417215 | T -> A | LOC_Os03g08570.1 | downstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:55.067; most accessible tissue: Callus, score: 86.995 | N | N | N | N |
| vg0304417215 | T -> A | LOC_Os03g08590.1 | downstream_gene_variant ; 1858.0bp to feature; MODIFIER | silent_mutation | Average:55.067; most accessible tissue: Callus, score: 86.995 | N | N | N | N |
| vg0304417215 | T -> A | LOC_Os03g08580.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.067; most accessible tissue: Callus, score: 86.995 | N | N | N | N |
| vg0304417215 | T -> A | LOC_Os03g08580.3 | intron_variant ; MODIFIER | silent_mutation | Average:55.067; most accessible tissue: Callus, score: 86.995 | N | N | N | N |
| vg0304417215 | T -> A | LOC_Os03g08580.2 | intron_variant ; MODIFIER | silent_mutation | Average:55.067; most accessible tissue: Callus, score: 86.995 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304417215 | NA | 5.86E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 7.52E-06 | mr1154 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 4.89E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 9.21E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 2.13E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | 9.00E-06 | NA | mr1671 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 4.52E-09 | mr1671 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 6.68E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 2.65E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 8.16E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | 7.43E-06 | NA | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 4.83E-10 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304417215 | NA | 6.80E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |