\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304415129:

Variant ID: vg0304415129 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4415129
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTCCTGTTATAGTTGAAATATAAAGATTTAAACCGTTGTAATTTAGCATTCAAACTTTAAATCCAGTGTGGATCTATGGAGCTATATCAAATAGGGCT[C/T]
AAGTCAAATTATCCTAAATTTGATTCAGTTTTGTAGAGAAGAGTCTTAACACCTACCACACCCAAGAAGTGAATTCTGAAAATAATAATTTTCATAATTG

Reverse complement sequence

CAATTATGAAAATTATTATTTTCAGAATTCACTTCTTGGGTGTGGTAGGTGTTAAGACTCTTCTCTACAAAACTGAATCAAATTTAGGATAATTTGACTT[G/A]
AGCCCTATTTGATATAGCTCCATAGATCCACACTGGATTTAAAGTTTGAATGCTAAATTACAACGGTTTAAATCTTTATATTTCAACTATAACAGGAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 1.00% 0.59% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 95.10% 3.10% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 90.40% 6.10% 3.52% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304415129 C -> T LOC_Os03g08580.1 upstream_gene_variant ; 1475.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 N N N N
vg0304415129 C -> T LOC_Os03g08580.3 upstream_gene_variant ; 1502.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 N N N N
vg0304415129 C -> T LOC_Os03g08580.2 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 N N N N
vg0304415129 C -> T LOC_Os03g08570.1 downstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 N N N N
vg0304415129 C -> T LOC_Os03g08590.1 downstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 N N N N
vg0304415129 C -> T LOC_Os03g08570-LOC_Os03g08580 intergenic_region ; MODIFIER silent_mutation Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304415129 5.72E-09 1.13E-10 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 6.03E-07 2.43E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 NA 4.46E-07 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 9.35E-08 1.88E-11 mr1585 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 1.50E-08 2.76E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 NA 6.46E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 2.33E-07 2.53E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 NA 3.18E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 3.54E-07 1.92E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304415129 NA 1.28E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251