\
| Variant ID: vg0304415129 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4415129 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCTCCTGTTATAGTTGAAATATAAAGATTTAAACCGTTGTAATTTAGCATTCAAACTTTAAATCCAGTGTGGATCTATGGAGCTATATCAAATAGGGCT[C/T]
AAGTCAAATTATCCTAAATTTGATTCAGTTTTGTAGAGAAGAGTCTTAACACCTACCACACCCAAGAAGTGAATTCTGAAAATAATAATTTTCATAATTG
CAATTATGAAAATTATTATTTTCAGAATTCACTTCTTGGGTGTGGTAGGTGTTAAGACTCTTCTCTACAAAACTGAATCAAATTTAGGATAATTTGACTT[G/A]
AGCCCTATTTGATATAGCTCCATAGATCCACACTGGATTTAAAGTTTGAATGCTAAATTACAACGGTTTAAATCTTTATATTTCAACTATAACAGGAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.40% | 1.00% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 95.10% | 3.10% | 1.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.40% | 6.10% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304415129 | C -> T | LOC_Os03g08580.1 | upstream_gene_variant ; 1475.0bp to feature; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 | N | N | N | N |
| vg0304415129 | C -> T | LOC_Os03g08580.3 | upstream_gene_variant ; 1502.0bp to feature; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 | N | N | N | N |
| vg0304415129 | C -> T | LOC_Os03g08580.2 | upstream_gene_variant ; 1518.0bp to feature; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 | N | N | N | N |
| vg0304415129 | C -> T | LOC_Os03g08570.1 | downstream_gene_variant ; 326.0bp to feature; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 | N | N | N | N |
| vg0304415129 | C -> T | LOC_Os03g08590.1 | downstream_gene_variant ; 3944.0bp to feature; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 | N | N | N | N |
| vg0304415129 | C -> T | LOC_Os03g08570-LOC_Os03g08580 | intergenic_region ; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 flower, score: 78.426 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304415129 | 5.72E-09 | 1.13E-10 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | 6.03E-07 | 2.43E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | NA | 4.46E-07 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | 9.35E-08 | 1.88E-11 | mr1585 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | 1.50E-08 | 2.76E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | NA | 6.46E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | 2.33E-07 | 2.53E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | NA | 3.18E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | 3.54E-07 | 1.92E-10 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304415129 | NA | 1.28E-06 | mr1693_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |