\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304365624:

Variant ID: vg0304365624 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4365624
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCTGTAATGTGCGAGACGAATTTATTAAGCCTAATTAATCCGTTATTTAGCAAATGTTTACTATAGCATCACATTGTTAAATTATGGTGTAATTAGGC[T/A]
CAAAAGATGCGTCTCGCGATTTACATGCAAATTGTGCAATTGGGTTTTTTTTTCGTTCACATTTAATGCTCCATGCATGTGTCCAAGTATTTGATGTGAC

Reverse complement sequence

GTCACATCAAATACTTGGACACATGCATGGAGCATTAAATGTGAACGAAAAAAAAACCCAATTGCACAATTTGCATGTAAATCGCGAGACGCATCTTTTG[A/T]
GCCTAATTACACCATAATTTAACAATGTGATGCTATAGTAAACATTTGCTAAATAACGGATTAATTAGGCTTAATAAATTCGTCTCGCACATTACAGGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 24.50% 1.52% 0.00% NA
All Indica  2759 56.50% 41.00% 2.50% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 32.90% 62.40% 4.71% 0.00% NA
Indica II  465 40.20% 57.80% 1.94% 0.00% NA
Indica III  913 74.70% 24.90% 0.44% 0.00% NA
Indica Intermediate  786 62.80% 33.60% 3.56% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304365624 T -> A LOC_Os03g08480.1 upstream_gene_variant ; 2300.0bp to feature; MODIFIER silent_mutation Average:78.374; most accessible tissue: Minghui63 root, score: 90.418 N N N N
vg0304365624 T -> A LOC_Os03g08480.2 upstream_gene_variant ; 2300.0bp to feature; MODIFIER silent_mutation Average:78.374; most accessible tissue: Minghui63 root, score: 90.418 N N N N
vg0304365624 T -> A LOC_Os03g08490.1 downstream_gene_variant ; 1493.0bp to feature; MODIFIER silent_mutation Average:78.374; most accessible tissue: Minghui63 root, score: 90.418 N N N N
vg0304365624 T -> A LOC_Os03g08480-LOC_Os03g08490 intergenic_region ; MODIFIER silent_mutation Average:78.374; most accessible tissue: Minghui63 root, score: 90.418 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304365624 T A -0.01 -0.01 0.0 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304365624 NA 4.63E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 5.87E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 2.63E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 6.50E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 1.95E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 3.91E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 3.30E-10 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 6.42E-06 mr1212_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 1.90E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 8.48E-06 2.74E-07 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 1.99E-06 1.99E-06 mr1387_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 1.47E-06 1.47E-06 mr1387_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 2.81E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 2.08E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 9.36E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 5.18E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 7.00E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 1.37E-06 NA mr1671_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 9.80E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 6.44E-06 NA mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 3.47E-06 3.47E-06 mr1765_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304365624 NA 6.58E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251