\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304336341:

Variant ID: vg0304336341 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4336341
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTTGTATCTTTTGATTTTTAGGAAAATCGTTTGGTCGCTAGGGCCCCTTTAATTTGAAAGAGAAACATAATTTAAACTTTTTTATCCATTGAGCGAC[A/G]
GCCTTTCCACTCAGCATCGTCGGATCACCAAGGCCGACTTTCGTCTTTGCTCGACAGATGAGTCTTGCAGTCAAGCTCCTTTCTGCCTTTGTACTTGAGG

Reverse complement sequence

CCTCAAGTACAAAGGCAGAAAGGAGCTTGACTGCAAGACTCATCTGTCGAGCAAAGACGAAAGTCGGCCTTGGTGATCCGACGATGCTGAGTGGAAAGGC[T/C]
GTCGCTCAATGGATAAAAAAGTTTAAATTATGTTTCTCTTTCAAATTAAAGGGGCCCTAGCGACCAAACGATTTTCCTAAAAATCAAAAGATACAACCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 21.60% 1.27% 0.00% NA
All Indica  2759 92.40% 5.50% 2.10% 0.00% NA
All Japonica  1512 47.70% 52.20% 0.13% 0.00% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 94.30% 1.70% 4.03% 0.00% NA
Indica II  465 88.60% 9.20% 2.15% 0.00% NA
Indica III  913 95.70% 3.80% 0.44% 0.00% NA
Indica Intermediate  786 89.40% 8.00% 2.54% 0.00% NA
Temperate Japonica  767 18.60% 81.10% 0.26% 0.00% NA
Tropical Japonica  504 84.50% 15.50% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304336341 A -> G LOC_Os03g08430.1 downstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:89.179; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0304336341 A -> G LOC_Os03g08440.1 downstream_gene_variant ; 320.0bp to feature; MODIFIER silent_mutation Average:89.179; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0304336341 A -> G LOC_Os03g08450.1 downstream_gene_variant ; 3109.0bp to feature; MODIFIER silent_mutation Average:89.179; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0304336341 A -> G LOC_Os03g08430.2 downstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:89.179; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0304336341 A -> G LOC_Os03g08440.2 downstream_gene_variant ; 939.0bp to feature; MODIFIER silent_mutation Average:89.179; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N
vg0304336341 A -> G LOC_Os03g08430-LOC_Os03g08440 intergenic_region ; MODIFIER silent_mutation Average:89.179; most accessible tissue: Minghui63 young leaf, score: 95.115 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304336341 A G 0.04 0.06 0.04 0.04 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304336341 NA 2.12E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 1.61E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 4.93E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 9.14E-09 mr1085 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 4.17E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 1.07E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 1.41E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 7.60E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 8.93E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 1.98E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 1.52E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 2.35E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 5.43E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 7.39E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 8.93E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 5.27E-11 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 8.33E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 1.70E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 7.09E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304336341 NA 6.75E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251