\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304319579:

Variant ID: vg0304319579 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 4319579
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCTCCATCGTCTCTTCGCAAACCAGTAGCTATAGCTAGCACCACATTGATTTGGTTCTTCGTGACAACAGGCTGTGCCATCTATGAAGTAAAGCAAT[G/A]
CCTTCCCTGCCCAACGAGGCAACGATACACCGCCATGCATGCAAAGCCCACGTGTAGTACCTGTTAACTCAGCACACAAATTCCCAATAAAGCAATTAAT

Reverse complement sequence

ATTAATTGCTTTATTGGGAATTTGTGTGCTGAGTTAACAGGTACTACACGTGGGCTTTGCATGCATGGCGGTGTATCGTTGCCTCGTTGGGCAGGGAAGG[C/T]
ATTGCTTTACTTCATAGATGGCACAGCCTGTTGTCACGAAGAACCAAATCAATGTGGTGCTAGCTATAGCTACTGGTTTGCGAAGAGACGATGGAGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.30% 0.25% 0.04% NA
All Indica  2759 97.60% 2.20% 0.14% 0.04% NA
All Japonica  1512 31.80% 67.80% 0.33% 0.07% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 94.60% 5.20% 0.22% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.10% 0.38% 0.00% NA
Temperate Japonica  767 5.50% 94.00% 0.52% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 86.30% 0.41% 0.41% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304319579 G -> A LOC_Os03g08420.1 upstream_gene_variant ; 198.0bp to feature; MODIFIER silent_mutation Average:86.423; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0304319579 G -> A LOC_Os03g08410-LOC_Os03g08420 intergenic_region ; MODIFIER silent_mutation Average:86.423; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0304319579 G -> DEL N N silent_mutation Average:86.423; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304319579 G A 0.09 0.06 0.08 0.01 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304319579 NA 7.18E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 2.11E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 2.66E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 1.17E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 6.71E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 3.53E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 1.79E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 4.59E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 8.82E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 2.21E-18 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 2.19E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 7.81E-10 1.88E-78 mr1671_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 7.54E-09 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 2.96E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 7.61E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 9.88E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 5.14E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 6.45E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 1.72E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304319579 NA 1.16E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251