\
| Variant ID: vg0304303829 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4303829 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 104. )
GTACATGCATGTACTGGTAGCTGTCAGAGAGAATTGCTAGATTTCAGTCACCTCAAAAGAAATTTTTAGTCATTTAAAAGAAGGGGGTATTTAACTTTTT[G/A]
TCATTTTTAAGATGTGGTAATTAATAATTTGCCACCCGTAATCTATAACACGTGGGCCCTCGTATGTCTATGGCATGTGGGCTTAGTGATAAATCTTTAA
TTAAAGATTTATCACTAAGCCCACATGCCATAGACATACGAGGGCCCACGTGTTATAGATTACGGGTGGCAAATTATTAATTACCACATCTTAAAAATGA[C/T]
AAAAAGTTAAATACCCCCTTCTTTTAAATGACTAAAAATTTCTTTTGAGGTGACTGAAATCTAGCAATTCTCTCTGACAGCTACCAGTACATGCATGTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 26.30% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 32.30% | 67.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 6.10% | 93.40% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.70% | 86.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 81.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 36.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304303829 | G -> A | LOC_Os03g08400-LOC_Os03g08410 | intergenic_region ; MODIFIER | silent_mutation | Average:47.707; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304303829 | NA | 7.52E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 2.78E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 9.20E-06 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | 2.83E-06 | NA | mr1671 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 1.08E-07 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 5.31E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 2.69E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 9.00E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 9.71E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 1.06E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 2.23E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 4.28E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 5.11E-19 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 2.42E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | 1.15E-08 | NA | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 1.60E-08 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 5.60E-21 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 1.42E-12 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 8.65E-15 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 1.18E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304303829 | NA | 1.07E-14 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |