| Variant ID: vg0304169062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 4169062 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, T: 0.01, others allele: 0.00, population size: 116. )
AAGTTATATACAAGTTACATTATAGTTACAGTGTAATTACATGCAAGTTACAGTGTAATTACACTATGATTGTACTATAATTACATCTGACAAATTTTTG[A/G]
AGGAAAATTTGTCGACAAATATATAGCAAATTCGTTTACGTAATCCCATATGTAACTCGTGCAGTTACATATGTAGGCGATGATTTATACGGTGATCGGC
GCCGATCACCGTATAAATCATCGCCTACATATGTAACTGCACGAGTTACATATGGGATTACGTAAACGAATTTGCTATATATTTGTCGACAAATTTTCCT[T/C]
CAAAAATTTGTCAGATGTAATTATAGTACAATCATAGTGTAATTACACTGTAACTTGCATGTAATTACACTGTAACTATAATGTAACTTGTATATAACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 48.50% | 51.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 11.50% | 88.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 34.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0304169062 | A -> G | LOC_Os03g08170.1 | upstream_gene_variant ; 4116.0bp to feature; MODIFIER | silent_mutation | Average:46.085; most accessible tissue: Callus, score: 68.571 | N | N | N | N |
| vg0304169062 | A -> G | LOC_Os03g08150-LOC_Os03g08170 | intergenic_region ; MODIFIER | silent_mutation | Average:46.085; most accessible tissue: Callus, score: 68.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0304169062 | NA | 2.30E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 6.16E-07 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | 2.37E-06 | 2.36E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 2.81E-09 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 1.51E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 1.34E-08 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 9.61E-07 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 3.73E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 3.02E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0304169062 | NA | 3.04E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/