| Variant ID: vg0303941671 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3941671 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 55. )
GTTAACCGGAGGTTCCTCAACTTAACAACGATATTTTTTGAGGTCTCTTAACCCACAAAATTAGAAATGTGTACCTCTAAACTCACACAAACCGTGCACT[T/C]
AAGGTTTTATGACAGTATGTATGGGTGGTTTCGCTGACGTGGCATCCTAGTCAGCAAAAAAAATTAAAAAGTACGTGGGGGCCCACAAGTCAGCTGCACA
TGTGCAGCTGACTTGTGGGCCCCCACGTACTTTTTAATTTTTTTTGCTGACTAGGATGCCACGTCAGCGAAACCACCCATACATACTGTCATAAAACCTT[A/G]
AGTGCACGGTTTGTGTGAGTTTAGAGGTACACATTTCTAATTTTGTGGGTTAAGAGACCTCAAAAAATATCGTTGTTAAGTTGAGGAACCTCCGGTTAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 20.60% | 1.21% | 1.35% | NA |
| All Indica | 2759 | 94.30% | 1.50% | 1.88% | 2.25% | NA |
| All Japonica | 1512 | 40.10% | 59.50% | 0.33% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 92.90% | 1.30% | 2.69% | 3.03% | NA |
| Indica II | 465 | 92.50% | 2.20% | 2.58% | 2.80% | NA |
| Indica III | 913 | 96.70% | 0.30% | 0.88% | 2.08% | NA |
| Indica Intermediate | 786 | 93.80% | 2.70% | 2.04% | 1.53% | NA |
| Temperate Japonica | 767 | 9.90% | 89.40% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.00% | 73.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303941671 | T -> C | LOC_Os03g07750.1 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:38.697; most accessible tissue: Callus, score: 69.281 | N | N | N | N |
| vg0303941671 | T -> C | LOC_Os03g07770.1 | upstream_gene_variant ; 3127.0bp to feature; MODIFIER | silent_mutation | Average:38.697; most accessible tissue: Callus, score: 69.281 | N | N | N | N |
| vg0303941671 | T -> C | LOC_Os03g07750.2 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:38.697; most accessible tissue: Callus, score: 69.281 | N | N | N | N |
| vg0303941671 | T -> C | LOC_Os03g07760.1 | downstream_gene_variant ; 438.0bp to feature; MODIFIER | silent_mutation | Average:38.697; most accessible tissue: Callus, score: 69.281 | N | N | N | N |
| vg0303941671 | T -> C | LOC_Os03g07750-LOC_Os03g07760 | intergenic_region ; MODIFIER | silent_mutation | Average:38.697; most accessible tissue: Callus, score: 69.281 | N | N | N | N |
| vg0303941671 | T -> DEL | N | N | silent_mutation | Average:38.697; most accessible tissue: Callus, score: 69.281 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303941671 | NA | 6.61E-16 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 3.37E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 1.25E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 1.36E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 8.62E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 2.19E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | 5.60E-06 | 5.60E-06 | mr1036_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 3.35E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 3.82E-11 | mr1347_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 7.26E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 2.51E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303941671 | NA | 3.36E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |