\
| Variant ID: vg0303811213 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3811213 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 209. )
TATGGGGCCCATATGTTGAATATTTTTAAAATGATTTCCTCGGTGATTTTCACTGACGTGGCTCATTGGCCTAGTCAAACCGGTTAAGTCAGCATATGAG[C/T]
CCCACATGTCAGTGTGAGTATTTTCAAAATGACTTCCTCGGTGGTTTTCACTAACGTGGCTCATTAACCTAGTCCAACCAGCTAAGTCAGCACATGGGGC
GCCCCATGTGCTGACTTAGCTGGTTGGACTAGGTTAATGAGCCACGTTAGTGAAAACCACCGAGGAAGTCATTTTGAAAATACTCACACTGACATGTGGG[G/A]
CTCATATGCTGACTTAACCGGTTTGACTAGGCCAATGAGCCACGTCAGTGAAAATCACCGAGGAAATCATTTTAAAAATATTCAACATATGGGCCCCATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 42.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.80% | 6.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.90% | 59.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303811213 | C -> T | LOC_Os03g07500.1 | upstream_gene_variant ; 435.0bp to feature; MODIFIER | silent_mutation | Average:53.764; most accessible tissue: Callus, score: 78.494 | N | N | N | N |
| vg0303811213 | C -> T | LOC_Os03g07490.1 | downstream_gene_variant ; 3414.0bp to feature; MODIFIER | silent_mutation | Average:53.764; most accessible tissue: Callus, score: 78.494 | N | N | N | N |
| vg0303811213 | C -> T | LOC_Os03g07510.1 | downstream_gene_variant ; 3158.0bp to feature; MODIFIER | silent_mutation | Average:53.764; most accessible tissue: Callus, score: 78.494 | N | N | N | N |
| vg0303811213 | C -> T | LOC_Os03g07510.2 | downstream_gene_variant ; 3158.0bp to feature; MODIFIER | silent_mutation | Average:53.764; most accessible tissue: Callus, score: 78.494 | N | N | N | N |
| vg0303811213 | C -> T | LOC_Os03g07500-LOC_Os03g07510 | intergenic_region ; MODIFIER | silent_mutation | Average:53.764; most accessible tissue: Callus, score: 78.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303811213 | NA | 6.28E-28 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 1.18E-44 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 4.57E-49 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 4.23E-27 | mr1571 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 2.40E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 5.61E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 9.05E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 6.76E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 6.04E-21 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 6.48E-26 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303811213 | NA | 1.22E-09 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |