\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303811213:

Variant ID: vg0303811213 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3811213
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TATGGGGCCCATATGTTGAATATTTTTAAAATGATTTCCTCGGTGATTTTCACTGACGTGGCTCATTGGCCTAGTCAAACCGGTTAAGTCAGCATATGAG[C/T]
CCCACATGTCAGTGTGAGTATTTTCAAAATGACTTCCTCGGTGGTTTTCACTAACGTGGCTCATTAACCTAGTCCAACCAGCTAAGTCAGCACATGGGGC

Reverse complement sequence

GCCCCATGTGCTGACTTAGCTGGTTGGACTAGGTTAATGAGCCACGTTAGTGAAAACCACCGAGGAAGTCATTTTGAAAATACTCACACTGACATGTGGG[G/A]
CTCATATGCTGACTTAACCGGTTTGACTAGGCCAATGAGCCACGTCAGTGAAAATCACCGAGGAAATCATTTTAAAAATATTCAACATATGGGCCCCATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 42.00% 0.02% 0.00% NA
All Indica  2759 93.80% 6.10% 0.04% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 40.90% 59.10% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 90.80% 9.20% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.50% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303811213 C -> T LOC_Os03g07500.1 upstream_gene_variant ; 435.0bp to feature; MODIFIER silent_mutation Average:53.764; most accessible tissue: Callus, score: 78.494 N N N N
vg0303811213 C -> T LOC_Os03g07490.1 downstream_gene_variant ; 3414.0bp to feature; MODIFIER silent_mutation Average:53.764; most accessible tissue: Callus, score: 78.494 N N N N
vg0303811213 C -> T LOC_Os03g07510.1 downstream_gene_variant ; 3158.0bp to feature; MODIFIER silent_mutation Average:53.764; most accessible tissue: Callus, score: 78.494 N N N N
vg0303811213 C -> T LOC_Os03g07510.2 downstream_gene_variant ; 3158.0bp to feature; MODIFIER silent_mutation Average:53.764; most accessible tissue: Callus, score: 78.494 N N N N
vg0303811213 C -> T LOC_Os03g07500-LOC_Os03g07510 intergenic_region ; MODIFIER silent_mutation Average:53.764; most accessible tissue: Callus, score: 78.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303811213 NA 6.28E-28 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 1.18E-44 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 4.57E-49 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 4.23E-27 mr1571 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 2.40E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 5.61E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 9.05E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 6.76E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 6.04E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 6.48E-26 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213 NA 1.22E-09 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251