Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0303811213:

Variant ID: vg0303811213 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3811213
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TATGGGGCCCATATGTTGAATATTTTTAAAATGATTTCCTCGGTGATTTTCACTGACGTGGCTCATTGGCCTAGTCAAACCGGTTAAGTCAGCATATGAG[C/T]
CCCACATGTCAGTGTGAGTATTTTCAAAATGACTTCCTCGGTGGTTTTCACTAACGTGGCTCATTAACCTAGTCCAACCAGCTAAGTCAGCACATGGGGC

Reverse complement sequence

GCCCCATGTGCTGACTTAGCTGGTTGGACTAGGTTAATGAGCCACGTTAGTGAAAACCACCGAGGAAGTCATTTTGAAAATACTCACACTGACATGTGGG[G/A]
CTCATATGCTGACTTAACCGGTTTGACTAGGCCAATGAGCCACGTCAGTGAAAATCACCGAGGAAATCATTTTAAAAATATTCAACATATGGGCCCCATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	42.00%	0.02%	0.00%	NA
All Indica	2759	93.80%	6.10%	0.04%	0.00%	NA
All Japonica	1512	0.30%	99.70%	0.00%	0.00%	NA
Aus	269	40.90%	59.10%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	90.80%	9.20%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.50%	0.13%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	40.00%	60.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303811213	C -> T	LOC_Os03g07500.1	upstream_gene_variant ; 435.0bp to feature; MODIFIER	silent_mutation	Average:53.764; most accessible tissue: Callus, score: 78.494	N	N	N	N
vg0303811213	C -> T	LOC_Os03g07490.1	downstream_gene_variant ; 3414.0bp to feature; MODIFIER	silent_mutation	Average:53.764; most accessible tissue: Callus, score: 78.494	N	N	N	N
vg0303811213	C -> T	LOC_Os03g07510.1	downstream_gene_variant ; 3158.0bp to feature; MODIFIER	silent_mutation	Average:53.764; most accessible tissue: Callus, score: 78.494	N	N	N	N
vg0303811213	C -> T	LOC_Os03g07510.2	downstream_gene_variant ; 3158.0bp to feature; MODIFIER	silent_mutation	Average:53.764; most accessible tissue: Callus, score: 78.494	N	N	N	N
vg0303811213	C -> T	LOC_Os03g07500-LOC_Os03g07510	intergenic_region ; MODIFIER	silent_mutation	Average:53.764; most accessible tissue: Callus, score: 78.494	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303811213	NA	6.28E-28	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	1.18E-44	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	4.57E-49	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	4.23E-27	mr1571	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	2.40E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	5.61E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	9.05E-29	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	6.76E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	6.04E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	6.48E-26	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303811213	NA	1.22E-09	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251