\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303788215:

Variant ID: vg0303788215 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3788215
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AACTAAGCGTTGCTTTCCTTTAGAGTGGTTGAAAAGCGCTGGCGCTAGGTATTTCAGCGGCTGGTGTCCAATCCAGTTGGATGTCCAAAATTTTGCCTTC[T/C]
GCCCATTACCGATTGTTACCTTTGTTGCGGCCACGAAGATTTGCTCATCTAACTCATCGTAGTGGGGTGTTGTCCCAACCCAAGGTTTGTCAGGGCACTC

Reverse complement sequence

GAGTGCCCTGACAAACCTTGGGTTGGGACAACACCCCACTACGATGAGTTAGATGAGCAAATCTTCGTGGCCGCAACAAAGGTAACAATCGGTAATGGGC[A/G]
GAAGGCAAAATTTTGGACATCCAACTGGATTGGACACCAGCCGCTGAAATACCTAGCGCCAGCGCTTTTCAACCACTCTAAAGGAAAGCAACGCTTAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.40% 14.60% 27.53% 29.54% NA
All Indica  2759 2.60% 5.50% 44.11% 47.84% NA
All Japonica  1512 80.40% 19.20% 0.20% 0.20% NA
Aus  269 0.70% 57.20% 22.68% 19.33% NA
Indica I  595 1.80% 2.20% 59.33% 36.64% NA
Indica II  465 6.00% 1.30% 42.37% 50.32% NA
Indica III  913 1.10% 9.30% 42.28% 47.32% NA
Indica Intermediate  786 2.80% 6.00% 35.75% 55.47% NA
Temperate Japonica  767 81.50% 17.90% 0.39% 0.26% NA
Tropical Japonica  504 92.50% 7.30% 0.00% 0.20% NA
Japonica Intermediate  241 51.90% 48.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 81.20% 3.12% 2.08% NA
Intermediate  90 42.20% 17.80% 18.89% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303788215 T -> C LOC_Os03g07460.1 missense_variant ; p.Gln59Arg; MODERATE nonsynonymous_codon ; Q59R Average:27.742; most accessible tissue: Minghui63 panicle, score: 38.588 possibly damaging -1.909 TOLERATED 1.00
vg0303788215 T -> DEL LOC_Os03g07460.1 N frameshift_variant Average:27.742; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303788215 NA 4.63E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 5.14E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 2.72E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 3.27E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 1.91E-12 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 5.21E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 1.02E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 3.13E-06 3.13E-06 mr1004_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 2.09E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 6.83E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 7.56E-09 mr1051_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 6.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 4.15E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 1.42E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 6.54E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 2.57E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 3.20E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215 NA 1.56E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251