Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303788215:

Variant ID: vg0303788215 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3788215
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AACTAAGCGTTGCTTTCCTTTAGAGTGGTTGAAAAGCGCTGGCGCTAGGTATTTCAGCGGCTGGTGTCCAATCCAGTTGGATGTCCAAAATTTTGCCTTC[T/C]
GCCCATTACCGATTGTTACCTTTGTTGCGGCCACGAAGATTTGCTCATCTAACTCATCGTAGTGGGGTGTTGTCCCAACCCAAGGTTTGTCAGGGCACTC

Reverse complement sequence

GAGTGCCCTGACAAACCTTGGGTTGGGACAACACCCCACTACGATGAGTTAGATGAGCAAATCTTCGTGGCCGCAACAAAGGTAACAATCGGTAATGGGC[A/G]
GAAGGCAAAATTTTGGACATCCAACTGGATTGGACACCAGCCGCTGAAATACCTAGCGCCAGCGCTTTTCAACCACTCTAAAGGAAAGCAACGCTTAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.40%	14.60%	27.53%	29.54%	NA
All Indica	2759	2.60%	5.50%	44.11%	47.84%	NA
All Japonica	1512	80.40%	19.20%	0.20%	0.20%	NA
Aus	269	0.70%	57.20%	22.68%	19.33%	NA
Indica I	595	1.80%	2.20%	59.33%	36.64%	NA
Indica II	465	6.00%	1.30%	42.37%	50.32%	NA
Indica III	913	1.10%	9.30%	42.28%	47.32%	NA
Indica Intermediate	786	2.80%	6.00%	35.75%	55.47%	NA
Temperate Japonica	767	81.50%	17.90%	0.39%	0.26%	NA
Tropical Japonica	504	92.50%	7.30%	0.00%	0.20%	NA
Japonica Intermediate	241	51.90%	48.10%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	81.20%	3.12%	2.08%	NA
Intermediate	90	42.20%	17.80%	18.89%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303788215	T -> C	LOC_Os03g07460.1	missense_variant ; p.Gln59Arg; MODERATE	nonsynonymous_codon ; Q59R	Average:27.742; most accessible tissue: Minghui63 panicle, score: 38.588	possibly damaging	-1.909	TOLERATED	1.00
vg0303788215	T -> DEL	LOC_Os03g07460.1	N	frameshift_variant	Average:27.742; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303788215	NA	4.63E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	5.14E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	2.72E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	3.27E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	1.91E-12	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	5.21E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	1.02E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	3.13E-06	3.13E-06	mr1004_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	2.09E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	6.83E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	7.56E-09	mr1051_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	6.42E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	4.15E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	1.42E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	6.54E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	2.57E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	3.20E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303788215	NA	1.56E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251