\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303752606:

Variant ID: vg0303752606 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3752606
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGATTGTTCCTCTAAGAGAGCCATATACAAATATGATTATCATTTTCTATTCCCAAGACCTTTTACTAGATGTATAACTTACTTACCATTGTATAAATT[G/A]
GAGATATTATTTATTTTACTTCACATCTTCGAAACTTGTAATGTTTGTATTATACTTTAAATTCTTTCAAATACAAATGTTATAAACTACAAAGTGGTAG

Reverse complement sequence

CTACCACTTTGTAGTTTATAACATTTGTATTTGAAAGAATTTAAAGTATAATACAAACATTACAAGTTTCGAAGATGTGAAGTAAAATAAATAATATCTC[C/T]
AATTTATACAATGGTAAGTAAGTTATACATCTAGTAAAAGGTCTTGGGAATAGAAAATGATAATCATATTTGTATATGGCTCTCTTAGAGGAACAATCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.30% 0.23% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 92.30% 7.00% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 78.80% 19.60% 1.59% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303752606 G -> A LOC_Os03g07380.1 upstream_gene_variant ; 2033.0bp to feature; MODIFIER silent_mutation Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0303752606 G -> A LOC_Os03g07390.1 upstream_gene_variant ; 730.0bp to feature; MODIFIER silent_mutation Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0303752606 G -> A LOC_Os03g07400.1 downstream_gene_variant ; 4914.0bp to feature; MODIFIER silent_mutation Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0303752606 G -> A LOC_Os03g07380-LOC_Os03g07390 intergenic_region ; MODIFIER silent_mutation Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303752606 NA 5.03E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 4.20E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 6.64E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 8.46E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 1.42E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 7.68E-08 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 1.23E-06 1.23E-06 mr1562_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 3.14E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 1.18E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303752606 NA 5.05E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251