\
| Variant ID: vg0303752606 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3752606 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGATTGTTCCTCTAAGAGAGCCATATACAAATATGATTATCATTTTCTATTCCCAAGACCTTTTACTAGATGTATAACTTACTTACCATTGTATAAATT[G/A]
GAGATATTATTTATTTTACTTCACATCTTCGAAACTTGTAATGTTTGTATTATACTTTAAATTCTTTCAAATACAAATGTTATAAACTACAAAGTGGTAG
CTACCACTTTGTAGTTTATAACATTTGTATTTGAAAGAATTTAAAGTATAATACAAACATTACAAGTTTCGAAGATGTGAAGTAAAATAAATAATATCTC[C/T]
AATTTATACAATGGTAAGTAAGTTATACATCTAGTAAAAGGTCTTGGGAATAGAAAATGATAATCATATTTGTATATGGCTCTCTTAGAGGAACAATCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 2.30% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.30% | 7.00% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.80% | 19.60% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303752606 | G -> A | LOC_Os03g07380.1 | upstream_gene_variant ; 2033.0bp to feature; MODIFIER | silent_mutation | Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0303752606 | G -> A | LOC_Os03g07390.1 | upstream_gene_variant ; 730.0bp to feature; MODIFIER | silent_mutation | Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0303752606 | G -> A | LOC_Os03g07400.1 | downstream_gene_variant ; 4914.0bp to feature; MODIFIER | silent_mutation | Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0303752606 | G -> A | LOC_Os03g07380-LOC_Os03g07390 | intergenic_region ; MODIFIER | silent_mutation | Average:22.888; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303752606 | NA | 5.03E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 4.20E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 6.64E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 8.46E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 1.42E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 7.68E-08 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | 1.23E-06 | 1.23E-06 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 3.14E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 1.18E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303752606 | NA | 5.05E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |