\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303605279:

Variant ID: vg0303605279 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3605279
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTACCTTTGTTTATCCTTGTTTACACATCGCGACCTTTCAAACCTTTGGCTCGAAGAGGGCTCCCCACCCTAGGCTCCGAACCCTTTAGGGAAGCCTG[C/T]
GACCACTTAGCAAACGAGGTCAAGCTCCCATGAGCCTGCGCCCCAACGCTACACATTTTGTTCGCTCTTTCCTTTCGGTGGCCTCCTTCCAATCTCTCTT

Reverse complement sequence

AAGAGAGATTGGAAGGAGGCCACCGAAAGGAAAGAGCGAACAAAATGTGTAGCGTTGGGGCGCAGGCTCATGGGAGCTTGACCTCGTTTGCTAAGTGGTC[G/A]
CAGGCTTCCCTAAAGGGTTCGGAGCCTAGGGTGGGGAGCCCTCTTCGAGCCAAAGGTTTGAAAGGTCGCGATGTGTAAACAAGGATAAACAAAGGTAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.30% 0.08% 0.00% NA
All Indica  2759 99.80% 0.10% 0.04% 0.00% NA
All Japonica  1512 80.10% 19.80% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 79.30% 20.50% 0.26% 0.00% NA
Tropical Japonica  504 93.10% 6.90% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 38.50% 1.04% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303605279 C -> T LOC_Os03g07060.1 upstream_gene_variant ; 2552.0bp to feature; MODIFIER silent_mutation Average:58.692; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N
vg0303605279 C -> T LOC_Os03g07070.1 downstream_gene_variant ; 1653.0bp to feature; MODIFIER silent_mutation Average:58.692; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N
vg0303605279 C -> T LOC_Os03g07060-LOC_Os03g07070 intergenic_region ; MODIFIER silent_mutation Average:58.692; most accessible tissue: Minghui63 flag leaf, score: 84.973 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303605279 NA 1.07E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0303605279 NA 2.48E-09 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 1.92E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 1.35E-06 1.73E-08 mr1280 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 2.77E-09 mr1280 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 2.74E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 7.97E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 1.16E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 2.36E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 1.38E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 1.15E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 8.06E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 7.45E-07 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 5.42E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 3.00E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 1.70E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303605279 NA 9.31E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251