\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303457724:

Variant ID: vg0303457724 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3457724
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAGTTTAATAAAGATAACAAATATAACCGTGAATGAATGATAACTTTCAGTTTTTTTTTTGCAACTTGTAAAAGTTGAATTTGGTTTCGCATGTTTGT[A/G]
GAGTGATGTATATTATATTTAATCTATGTTGTTAACTTTTTTTTTATTTTTTTATAACTATTTAGATGACATGTAAGAGGATATCCTCTTGAGAGATGAA

Reverse complement sequence

TTCATCTCTCAAGAGGATATCCTCTTACATGTCATCTAAATAGTTATAAAAAAATAAAAAAAAAGTTAACAACATAGATTAAATATAATATACATCACTC[T/C]
ACAAACATGCGAAACCAAATTCAACTTTTACAAGTTGCAAAAAAAAAACTGAAAGTTATCATTCATTCACGGTTATATTTGTTATCTTTATTAAACTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 26.20% 1.93% 1.63% NA
All Indica  2759 96.80% 1.10% 0.83% 1.27% NA
All Japonica  1512 16.30% 77.10% 3.90% 2.78% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 0.20% 0.67% 1.51% NA
Indica II  465 92.30% 4.30% 1.29% 2.15% NA
Indica III  913 99.20% 0.10% 0.44% 0.22% NA
Indica Intermediate  786 96.20% 0.90% 1.15% 1.78% NA
Temperate Japonica  767 14.70% 73.30% 6.65% 5.35% NA
Tropical Japonica  504 5.40% 93.70% 0.79% 0.20% NA
Japonica Intermediate  241 44.00% 54.40% 1.66% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 55.60% 34.40% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303457724 A -> DEL N N silent_mutation Average:18.4; most accessible tissue: Callus, score: 64.033 N N N N
vg0303457724 A -> G LOC_Os03g06800.1 upstream_gene_variant ; 4716.0bp to feature; MODIFIER silent_mutation Average:18.4; most accessible tissue: Callus, score: 64.033 N N N N
vg0303457724 A -> G LOC_Os03g06810.1 upstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:18.4; most accessible tissue: Callus, score: 64.033 N N N N
vg0303457724 A -> G LOC_Os03g06820.1 downstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:18.4; most accessible tissue: Callus, score: 64.033 N N N N
vg0303457724 A -> G LOC_Os03g06810-LOC_Os03g06820 intergenic_region ; MODIFIER silent_mutation Average:18.4; most accessible tissue: Callus, score: 64.033 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303457724 NA 9.89E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 1.42E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.08E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.00E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 6.31E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 1.24E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.68E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.69E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 5.27E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 1.90E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 1.15E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 4.91E-15 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 5.02E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 1.22E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.94E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.81E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 8.66E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 1.02E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 2.86E-06 1.34E-06 mr1831_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 3.83E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 2.78E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724 NA 8.65E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251