Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303457724:

Variant ID: vg0303457724 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3457724
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAAGTTTAATAAAGATAACAAATATAACCGTGAATGAATGATAACTTTCAGTTTTTTTTTTGCAACTTGTAAAAGTTGAATTTGGTTTCGCATGTTTGT[A/G]
GAGTGATGTATATTATATTTAATCTATGTTGTTAACTTTTTTTTTATTTTTTTATAACTATTTAGATGACATGTAAGAGGATATCCTCTTGAGAGATGAA

Reverse complement sequence

TTCATCTCTCAAGAGGATATCCTCTTACATGTCATCTAAATAGTTATAAAAAAATAAAAAAAAAGTTAACAACATAGATTAAATATAATATACATCACTC[T/C]
ACAAACATGCGAAACCAAATTCAACTTTTACAAGTTGCAAAAAAAAAACTGAAAGTTATCATTCATTCACGGTTATATTTGTTATCTTTATTAAACTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.20%	26.20%	1.93%	1.63%	NA
All Indica	2759	96.80%	1.10%	0.83%	1.27%	NA
All Japonica	1512	16.30%	77.10%	3.90%	2.78%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	0.20%	0.67%	1.51%	NA
Indica II	465	92.30%	4.30%	1.29%	2.15%	NA
Indica III	913	99.20%	0.10%	0.44%	0.22%	NA
Indica Intermediate	786	96.20%	0.90%	1.15%	1.78%	NA
Temperate Japonica	767	14.70%	73.30%	6.65%	5.35%	NA
Tropical Japonica	504	5.40%	93.70%	0.79%	0.20%	NA
Japonica Intermediate	241	44.00%	54.40%	1.66%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	55.60%	34.40%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303457724	A -> DEL	N	N	silent_mutation	Average:18.4; most accessible tissue: Callus, score: 64.033	N	N	N	N
vg0303457724	A -> G	LOC_Os03g06800.1	upstream_gene_variant ; 4716.0bp to feature; MODIFIER	silent_mutation	Average:18.4; most accessible tissue: Callus, score: 64.033	N	N	N	N
vg0303457724	A -> G	LOC_Os03g06810.1	upstream_gene_variant ; 2365.0bp to feature; MODIFIER	silent_mutation	Average:18.4; most accessible tissue: Callus, score: 64.033	N	N	N	N
vg0303457724	A -> G	LOC_Os03g06820.1	downstream_gene_variant ; 984.0bp to feature; MODIFIER	silent_mutation	Average:18.4; most accessible tissue: Callus, score: 64.033	N	N	N	N
vg0303457724	A -> G	LOC_Os03g06810-LOC_Os03g06820	intergenic_region ; MODIFIER	silent_mutation	Average:18.4; most accessible tissue: Callus, score: 64.033	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303457724	NA	9.89E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	1.42E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.08E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.00E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	6.31E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	1.24E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.68E-06	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.69E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	5.27E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	1.90E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	1.15E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	4.91E-15	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	5.02E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	1.22E-08	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.94E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.81E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	8.66E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	1.02E-17	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	2.86E-06	1.34E-06	mr1831_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	3.83E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	2.78E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303457724	NA	8.65E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251