Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303448503:

Variant ID: vg0303448503 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3448503
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCTCACTACTGGAGAAACCATTATTAAAAACCGGGACTAAAAATAATTTTTAAATCCAAATTTATAAGAGCAACATCACTATTTAATTATTAGTGCCG[A/G]
TTGGTAACACCAACCGGGACTAAAGATGATCATCTTTAGTCCCGGTTCACACGTTATCAGGGTTTGTCAGCACCCCCCCCCCTTCCCCATTGCAGTGCGT

Reverse complement sequence

ACGCACTGCAATGGGGAAGGGGGGGGGGTGCTGACAAACCCTGATAACGTGTGAACCGGGACTAAAGATGATCATCTTTAGTCCCGGTTGGTGTTACCAA[T/C]
CGGCACTAATAATTAAATAGTGATGTTGCTCTTATAAATTTGGATTTAAAAATTATTTTTAGTCCCGGTTTTTAATAATGGTTTCTCCAGTAGTGAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	34.90%	0.36%	0.00%	NA
All Indica	2759	54.60%	45.20%	0.18%	0.00%	NA
All Japonica	1512	82.40%	16.90%	0.66%	0.00%	NA
Aus	269	68.40%	30.90%	0.74%	0.00%	NA
Indica I	595	23.40%	76.50%	0.17%	0.00%	NA
Indica II	465	35.70%	64.10%	0.22%	0.00%	NA
Indica III	913	77.30%	22.60%	0.11%	0.00%	NA
Indica Intermediate	786	63.10%	36.60%	0.25%	0.00%	NA
Temperate Japonica	767	83.70%	15.30%	1.04%	0.00%	NA
Tropical Japonica	504	94.00%	6.00%	0.00%	0.00%	NA
Japonica Intermediate	241	53.90%	45.20%	0.83%	0.00%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303448503	A -> G	LOC_Os03g06780.1	upstream_gene_variant ; 1250.0bp to feature; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Callus, score: 85.991	N	N	N	N
vg0303448503	A -> G	LOC_Os03g06790.1	downstream_gene_variant ; 1000.0bp to feature; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Callus, score: 85.991	N	N	N	N
vg0303448503	A -> G	LOC_Os03g06800.1	downstream_gene_variant ; 4239.0bp to feature; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Callus, score: 85.991	N	N	N	N
vg0303448503	A -> G	LOC_Os03g06780-LOC_Os03g06790	intergenic_region ; MODIFIER	silent_mutation	Average:46.789; most accessible tissue: Callus, score: 85.991	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303448503	NA	1.32E-08	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	2.22E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	2.44E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	1.59E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	3.50E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	8.85E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	3.11E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	2.03E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	NA	1.93E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303448503	3.68E-06	3.55E-10	mr1974_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251