\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303329795:

Variant ID: vg0303329795 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3329795
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ATACGAAGACACATTTAAAGTATTAAACGTAGACTAATAACAAAATAAATTACATATTCCGACTGTAAACTGCGAGACGAATCTATTAAACCTAATTTAT[C/T]
CATCATTAGCAAATGTTTATTGTAGCACCACATTGTCAAATCATGGCGTAATTAGGCTCAAAAGATTCGTCTCGCAATTTACATGCAAACTGTGCAATTA

Reverse complement sequence

TAATTGCACAGTTTGCATGTAAATTGCGAGACGAATCTTTTGAGCCTAATTACGCCATGATTTGACAATGTGGTGCTACAATAAACATTTGCTAATGATG[G/A]
ATAAATTAGGTTTAATAGATTCGTCTCGCAGTTTACAGTCGGAATATGTAATTTATTTTGTTATTAGTCTACGTTTAATACTTTAAATGTGTCTTCGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 48.60% 0.34% 0.00% NA
All Indica  2759 27.40% 72.10% 0.47% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 10.80% 89.20% 0.00% 0.00% NA
Indica I  595 1.50% 98.30% 0.17% 0.00% NA
Indica II  465 64.30% 35.10% 0.65% 0.00% NA
Indica III  913 25.00% 74.50% 0.55% 0.00% NA
Indica Intermediate  786 28.00% 71.50% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 56.20% 42.70% 1.04% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303329795 C -> T LOC_Os03g06610-LOC_Os03g06620 intergenic_region ; MODIFIER silent_mutation Average:89.434; most accessible tissue: Minghui63 panicle, score: 98.402 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0303329795 C T 0.02 0.02 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303329795 3.00E-06 3.01E-10 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 1.61E-06 5.88E-11 mr1192 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 3.80E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 1.16E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 7.81E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 2.71E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 4.01E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 1.95E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 3.59E-12 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303329795 NA 8.77E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251