\
| Variant ID: vg0303295477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3295477 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 103. )
TGTGGTAAAGATAGTGACGGAGCGTGGGGCTCCTCACCGGGAGACCGCGCAGGCCCCCCTTTGCCGGTTCGGCCGGGGACCCTGGGTGAGATTCTAAGCT[T/C]
CTAGTCTGTGGAAGGTTCGCGAGAATGGAAGAAGCACAAGACACGGGCGATGTATACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTGTTC
GAACACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTATACATCGCCCGTGTCTTGTGCTTCTTCCATTCTCGCGAACCTTCCACAGACTAG[A/G]
AGCTTAGAATCTCACCCAGGGTCCCCGGCCGAACCGGCAAAGGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCCCACGCTCCGTCACTATCTTTACCACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.00% | 42.60% | 13.99% | 0.47% | NA |
| All Indica | 2759 | 37.40% | 45.80% | 16.20% | 0.51% | NA |
| All Japonica | 1512 | 59.50% | 38.80% | 1.65% | 0.00% | NA |
| Aus | 269 | 1.10% | 40.50% | 56.13% | 2.23% | NA |
| Indica I | 595 | 9.20% | 61.70% | 28.07% | 1.01% | NA |
| Indica II | 465 | 69.70% | 19.10% | 11.18% | 0.00% | NA |
| Indica III | 913 | 32.30% | 54.70% | 12.38% | 0.66% | NA |
| Indica Intermediate | 786 | 45.70% | 39.40% | 14.63% | 0.25% | NA |
| Temperate Japonica | 767 | 94.00% | 4.80% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 11.90% | 87.30% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.40% | 45.60% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 19.80% | 22.92% | 2.08% | NA |
| Intermediate | 90 | 46.70% | 35.60% | 17.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303295477 | T -> C | LOC_Os03g06550.1 | upstream_gene_variant ; 1624.0bp to feature; MODIFIER | silent_mutation | Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 | N | N | N | N |
| vg0303295477 | T -> C | LOC_Os03g06540.1 | downstream_gene_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 | N | N | N | N |
| vg0303295477 | T -> C | LOC_Os03g06540-LOC_Os03g06550 | intergenic_region ; MODIFIER | silent_mutation | Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 | N | N | N | N |
| vg0303295477 | T -> DEL | N | N | silent_mutation | Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303295477 | NA | 9.19E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 3.34E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 2.69E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 1.77E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 8.03E-08 | mr1668 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 5.67E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 5.68E-08 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 6.57E-07 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 4.93E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 3.00E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 4.75E-09 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303295477 | NA | 1.29E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |