\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303295477:

Variant ID: vg0303295477 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3295477
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGGTAAAGATAGTGACGGAGCGTGGGGCTCCTCACCGGGAGACCGCGCAGGCCCCCCTTTGCCGGTTCGGCCGGGGACCCTGGGTGAGATTCTAAGCT[T/C]
CTAGTCTGTGGAAGGTTCGCGAGAATGGAAGAAGCACAAGACACGGGCGATGTATACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTGTTC

Reverse complement sequence

GAACACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTATACATCGCCCGTGTCTTGTGCTTCTTCCATTCTCGCGAACCTTCCACAGACTAG[A/G]
AGCTTAGAATCTCACCCAGGGTCCCCGGCCGAACCGGCAAAGGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCCCACGCTCCGTCACTATCTTTACCACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 42.60% 13.99% 0.47% NA
All Indica  2759 37.40% 45.80% 16.20% 0.51% NA
All Japonica  1512 59.50% 38.80% 1.65% 0.00% NA
Aus  269 1.10% 40.50% 56.13% 2.23% NA
Indica I  595 9.20% 61.70% 28.07% 1.01% NA
Indica II  465 69.70% 19.10% 11.18% 0.00% NA
Indica III  913 32.30% 54.70% 12.38% 0.66% NA
Indica Intermediate  786 45.70% 39.40% 14.63% 0.25% NA
Temperate Japonica  767 94.00% 4.80% 1.17% 0.00% NA
Tropical Japonica  504 11.90% 87.30% 0.79% 0.00% NA
Japonica Intermediate  241 49.40% 45.60% 4.98% 0.00% NA
VI/Aromatic  96 55.20% 19.80% 22.92% 2.08% NA
Intermediate  90 46.70% 35.60% 17.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303295477 T -> C LOC_Os03g06550.1 upstream_gene_variant ; 1624.0bp to feature; MODIFIER silent_mutation Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N
vg0303295477 T -> C LOC_Os03g06540.1 downstream_gene_variant ; 1052.0bp to feature; MODIFIER silent_mutation Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N
vg0303295477 T -> C LOC_Os03g06540-LOC_Os03g06550 intergenic_region ; MODIFIER silent_mutation Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N
vg0303295477 T -> DEL N N silent_mutation Average:50.34; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303295477 NA 9.19E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 3.34E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 2.69E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 1.77E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 8.03E-08 mr1668 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 5.67E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 5.68E-08 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 6.57E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 4.93E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 3.00E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 4.75E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303295477 NA 1.29E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251