Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0303236377:

Variant ID: vg0303236377 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3236377
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CAGCAAGACTGGCTCAATCTTTGAGATTAGACTTGTGCCTAGGTTTAGTAGTAAATCAAAAAGTACATCCTTGGCTAGTTGTCATGCCTATTTGCTCCCT[T/C]
CCCCAAGACAAGGCCAATCTTCTTGAATTGAGAGCATACTTGACCAAGAATATGGCATGAGGAAATACTACTATCCTGAAGGCTGTTTCACTGGTTGGTG

Reverse complement sequence

CACCAACCAGTGAAACAGCCTTCAGGATAGTAGTATTTCCTCATGCCATATTCTTGGTCAAGTATGCTCTCAATTCAAGAAGATTGGCCTTGTCTTGGGG[A/G]
AGGGAGCAAATAGGCATGACAACTAGCCAAGGATGTACTTTTTGATTTACTACTAAACCTAGGCACAAGTCTAATCTCAAAGATTGAGCCAGTCTTGCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	37.40%	0.11%	0.04%	NA
All Indica	2759	95.40%	4.40%	0.14%	0.07%	NA
All Japonica	1512	0.40%	99.60%	0.00%	0.00%	NA
Aus	269	85.10%	14.90%	0.00%	0.00%	NA
Indica I	595	99.30%	0.30%	0.34%	0.00%	NA
Indica II	465	94.60%	5.20%	0.22%	0.00%	NA
Indica III	913	95.20%	4.70%	0.00%	0.11%	NA
Indica Intermediate	786	93.00%	6.70%	0.13%	0.13%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303236377	T -> C	LOC_Os03g06460.1	upstream_gene_variant ; 2869.0bp to feature; MODIFIER	silent_mutation	Average:65.656; most accessible tissue: Callus, score: 98.577	N	N	N	N
vg0303236377	T -> C	LOC_Os03g06470.1	downstream_gene_variant ; 2095.0bp to feature; MODIFIER	silent_mutation	Average:65.656; most accessible tissue: Callus, score: 98.577	N	N	N	N
vg0303236377	T -> C	LOC_Os03g06460-LOC_Os03g06470	intergenic_region ; MODIFIER	silent_mutation	Average:65.656; most accessible tissue: Callus, score: 98.577	N	N	N	N
vg0303236377	T -> DEL	N	N	silent_mutation	Average:65.656; most accessible tissue: Callus, score: 98.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303236377	NA	1.71E-19	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	1.16E-35	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	5.73E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	6.63E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	2.57E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	6.96E-07	NA	mr1383_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	1.73E-24	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	1.19E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303236377	NA	3.71E-34	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251