\
| Variant ID: vg0303228694 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3228694 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTTTGAGTTTTTACTTGCAACGTTTGACCATTCGTCTTATTCAAATTTTTTTGAAATTATTATTTATTTTATTTGTGACTTACTTTATTATCTACAGTA[T/C]
TTTAAGCACAACTTTTTGTTTTTTATATTTGCAAAAAAAAATTAAATAAGACGAGTGGTCAAACGTTGCAATTAAAAAATTAAAATCCCTTATAATGTGA
TCACATTATAAGGGATTTTAATTTTTTAATTGCAACGTTTGACCACTCGTCTTATTTAATTTTTTTTTGCAAATATAAAAAACAAAAAGTTGTGCTTAAA[A/G]
TACTGTAGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAAATTTGAATAAGACGAATGGTCAAACGTTGCAAGTAAAAACTCAAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 12.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 90.10% | 9.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.40% | 89.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.00% | 22.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303228694 | T -> C | LOC_Os03g06460.1 | downstream_gene_variant ; 283.0bp to feature; MODIFIER | silent_mutation | Average:50.079; most accessible tissue: Callus, score: 87.102 | N | N | N | N |
| vg0303228694 | T -> C | LOC_Os03g06440-LOC_Os03g06460 | intergenic_region ; MODIFIER | silent_mutation | Average:50.079; most accessible tissue: Callus, score: 87.102 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303228694 | NA | 5.72E-26 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 1.34E-30 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 2.29E-12 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 6.60E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 1.45E-10 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 1.83E-32 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 2.58E-19 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 3.01E-19 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 2.20E-22 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 1.25E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 2.50E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 1.96E-08 | mr1511_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 7.30E-09 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303228694 | NA | 4.82E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |