\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303210296:

Variant ID: vg0303210296 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3210296
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.39, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CTATCTGCAAACTAACCTTGGTAGTGTGTATAGAGTAACCGAGAATGGCCATCTTTCACCTGGATGGTGGTTCTGCATAGTTCATCAACAGGAGGTACTT[C/T]
AGGCAGGCAAAGCACCTCAAGTATGCATGGCAGCGTGAAACTGCGGTGAATGACTTGGTGGTGAGACTGTTGGTTGTCTGGATGAGAGCACAGCAGTTTC

Reverse complement sequence

GAAACTGCTGTGCTCTCATCCAGACAACCAACAGTCTCACCACCAAGTCATTCACCGCAGTTTCACGCTGCCATGCATACTTGAGGTGCTTTGCCTGCCT[G/A]
AAGTACCTCCTGTTGATGAACTATGCAGAACCACCATCCAGGTGAAAGATGGCCATTCTCGGTTACTCTATACACACTACCAAGGTTAGTTTGCAGATAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 38.20% 0.08% 0.00% NA
All Indica  2759 93.90% 6.00% 0.14% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 87.60% 12.10% 0.34% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.50% 0.25% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303210296 C -> T LOC_Os03g06420.1 3_prime_UTR_variant ; 131.0bp to feature; MODIFIER silent_mutation Average:81.629; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0303210296 C -> T LOC_Os03g06420.3 3_prime_UTR_variant ; 131.0bp to feature; MODIFIER silent_mutation Average:81.629; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0303210296 C -> T LOC_Os03g06420.4 3_prime_UTR_variant ; 131.0bp to feature; MODIFIER silent_mutation Average:81.629; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0303210296 C -> T LOC_Os03g06420.2 3_prime_UTR_variant ; 131.0bp to feature; MODIFIER silent_mutation Average:81.629; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0303210296 C -> T LOC_Os03g06410.1 downstream_gene_variant ; 1997.0bp to feature; MODIFIER silent_mutation Average:81.629; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0303210296 C -> T LOC_Os03g06430.1 downstream_gene_variant ; 2463.0bp to feature; MODIFIER silent_mutation Average:81.629; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0303210296 C T -0.03 -0.03 -0.04 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303210296 NA 1.68E-39 mr1105 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 2.24E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 3.25E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 3.14E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 5.01E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 1.32E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 4.49E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 7.87E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 7.87E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303210296 NA 5.55E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251