Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303197045:

Variant ID: vg0303197045 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3197045
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTAGTACTTCCTCCGTCCTTAAAAATAGCTACCTACTACAGGATTTGATATTACCTAGTACTATAGTACTATGAATCTATACAGATATTCTGTGCTAG[A/T]
TAGCTATATTTTAGAATGGATATAGGTGGTAGTACCAAATAATCGCTTCTTATAATTATAAGCTTTCTCTAACGTGTCTCGTGGTGCGGTGCAGATAGGG

Reverse complement sequence

CCCTATCTGCACCGCACCACGAGACACGTTAGAGAAAGCTTATAATTATAAGAAGCGATTATTTGGTACTACCACCTATATCCATTCTAAAATATAGCTA[T/A]
CTAGCACAGAATATCTGTATAGATTCATAGTACTATAGTACTAGGTAATATCAAATCCTGTAGTAGGTAGCTATTTTTAAGGACGGAGGAAGTACTAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 3.00% 3.55% 1.33% NA
All Indica  2759 97.50% 0.20% 0.07% 2.25% NA
All Japonica  1512 80.50% 8.90% 10.52% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 94.20% 1.10% 0.22% 4.52% NA
Indica III  913 97.70% 0.00% 0.00% 2.30% NA
Indica Intermediate  786 97.50% 0.00% 0.13% 2.42% NA
Temperate Japonica  767 64.50% 16.80% 18.51% 0.13% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 92.10% 1.20% 6.64% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 91.10% 3.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303197045 A -> T LOC_Os03g06390.1 upstream_gene_variant ; 384.0bp to feature; MODIFIER silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N
vg0303197045 A -> T LOC_Os03g06400.1 upstream_gene_variant ; 649.0bp to feature; MODIFIER silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N
vg0303197045 A -> T LOC_Os03g06410.1 upstream_gene_variant ; 4267.0bp to feature; MODIFIER silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N
vg0303197045 A -> T LOC_Os03g06400.2 upstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N
vg0303197045 A -> T LOC_Os03g06379.1 downstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N
vg0303197045 A -> T LOC_Os03g06390-LOC_Os03g06400 intergenic_region ; MODIFIER silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N
vg0303197045 A -> DEL N N silent_mutation Average:98.236; most accessible tissue: Minghui63 flower, score: 99.254 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0303197045 A T 0.03 0.0 -0.03 0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303197045 NA 5.84E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303197045 NA 1.20E-07 mr1712 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303197045 6.88E-07 6.88E-07 mr1910 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303197045 NA 2.65E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251