\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303196975:

Variant ID: vg0303196975 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3196975
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGAATCTAGAAAATAAATTAAAGATCGAGAGCTGGGAAACTCGATTTTTTTTTAAATTCTCATAATCTAACTAGTACTTCCTCCGTCCTTAAAAATAG[C/T]
TACCTACTACAGGATTTGATATTACCTAGTACTATAGTACTATGAATCTATACAGATATTCTGTGCTAGATAGCTATATTTTAGAATGGATATAGGTGGT

Reverse complement sequence

ACCACCTATATCCATTCTAAAATATAGCTATCTAGCACAGAATATCTGTATAGATTCATAGTACTATAGTACTAGGTAATATCAAATCCTGTAGTAGGTA[G/A]
CTATTTTTAAGGACGGAGGAAGTACTAGTTAGATTATGAGAATTTAAAAAAAAATCGAGTTTCCCAGCTCTCGATCTTTAATTTATTTTCTAGATTCTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.10% 0.74% 0.08% NA
All Indica  2759 96.20% 2.50% 1.16% 0.14% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 87.70% 11.90% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 93.10% 5.40% 1.29% 0.22% NA
Indica III  913 96.50% 2.10% 1.31% 0.11% NA
Indica Intermediate  786 95.00% 3.30% 1.40% 0.25% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303196975 C -> T LOC_Os03g06390.1 upstream_gene_variant ; 314.0bp to feature; MODIFIER silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N
vg0303196975 C -> T LOC_Os03g06400.1 upstream_gene_variant ; 719.0bp to feature; MODIFIER silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N
vg0303196975 C -> T LOC_Os03g06410.1 upstream_gene_variant ; 4337.0bp to feature; MODIFIER silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N
vg0303196975 C -> T LOC_Os03g06400.2 upstream_gene_variant ; 680.0bp to feature; MODIFIER silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N
vg0303196975 C -> T LOC_Os03g06379.1 downstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N
vg0303196975 C -> T LOC_Os03g06390-LOC_Os03g06400 intergenic_region ; MODIFIER silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N
vg0303196975 C -> DEL N N silent_mutation Average:96.904; most accessible tissue: Callus, score: 98.763 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0303196975 C T -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303196975 NA 3.98E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 7.60E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 1.38E-36 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 2.25E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 2.48E-07 NA mr1117 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 1.91E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 7.48E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 6.99E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 3.70E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 3.10E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 9.15E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 2.70E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 7.53E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 7.53E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 4.99E-06 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 3.87E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 3.41E-38 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 1.12E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 8.45E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 3.06E-06 NA mr1961 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 2.14E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 3.53E-103 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 7.83E-99 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 2.65E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 3.12E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 3.15E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 1.45E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 7.19E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 4.17E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 1.48E-44 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 3.06E-100 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 2.62E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 8.11E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 2.90E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303196975 NA 2.43E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251