\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303087401:

Variant ID: vg0303087401 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 3087401
Reference Allele: GAlternative Allele: A,GTTTA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGGAAGAAGACTTGTGTGCGTCATGATGTAGTGATTTAATTTTTCTTACTAATGTTGTGTTTAGTTCCACGTTAAAATTGGAAGTTTGACTAAAATTA[G/A,GTTTA]
AAGAAAAAATATTGAAAATTTATGTATGTAGAAAAAATTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAATAGTTAGGAACTAAATAAGGTCTAAGCA

Reverse complement sequence

TGCTTAGACCTTATTTAGTTCCTAACTATTTCTTCAAACTTTCAACTTTTCCATCACATCAAATTTTTTCTACATACATAAATTTTCAATATTTTTTCTT[C/T,TAAAC]
TAATTTTAGTCAAACTTCCAATTTTAACGTGGAACTAAACACAACATTAGTAAGAAAAATTAAATCACTACATCATGACGCACACAAGTCTTCTTCCTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 42.30% 2.14% 0.23% GTTTA: 0.42%
All Indica  2759 91.50% 4.10% 3.33% 0.33% GTTTA: 0.69%
All Japonica  1512 0.30% 99.60% 0.00% 0.07% NA
Aus  269 8.90% 89.20% 1.86% 0.00% NA
Indica I  595 95.10% 1.80% 2.52% 0.34% GTTTA: 0.17%
Indica II  465 89.20% 6.70% 3.66% 0.22% GTTTA: 0.22%
Indica III  913 93.10% 1.50% 4.05% 0.22% GTTTA: 1.10%
Indica Intermediate  786 88.30% 7.40% 2.93% 0.51% GTTTA: 0.89%
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.41% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 38.90% 54.40% 4.44% 1.11% GTTTA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303087401 G -> A LOC_Os03g06139.1 upstream_gene_variant ; 1412.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N
vg0303087401 G -> A LOC_Os03g06160.1 upstream_gene_variant ; 4456.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N
vg0303087401 G -> A LOC_Os03g06139-LOC_Os03g06160 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N
vg0303087401 G -> GTTTA LOC_Os03g06139.1 upstream_gene_variant ; 1413.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N
vg0303087401 G -> GTTTA LOC_Os03g06160.1 upstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N
vg0303087401 G -> GTTTA LOC_Os03g06139-LOC_Os03g06160 intergenic_region ; MODIFIER silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N
vg0303087401 G -> DEL N N silent_mutation Average:50.038; most accessible tissue: Callus, score: 68.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303087401 NA 4.11E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.38E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 2.29E-52 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 2.53E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 2.48E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 5.76E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.41E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 3.96E-24 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 7.41E-07 mr1706 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.10E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 8.93E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.30E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 6.42E-56 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 3.65E-34 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 7.39E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 4.81E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 2.45E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 8.73E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.07E-33 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.49E-30 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 6.21E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.92E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 2.80E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 3.02E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 3.50E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401 NA 1.88E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251