Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303087401:

Variant ID: vg0303087401 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 3087401
Reference Allele: G	Alternative Allele: A,GTTTA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGGAAGAAGACTTGTGTGCGTCATGATGTAGTGATTTAATTTTTCTTACTAATGTTGTGTTTAGTTCCACGTTAAAATTGGAAGTTTGACTAAAATTA[G/A,GTTTA]
AAGAAAAAATATTGAAAATTTATGTATGTAGAAAAAATTTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAATAGTTAGGAACTAAATAAGGTCTAAGCA

Reverse complement sequence

TGCTTAGACCTTATTTAGTTCCTAACTATTTCTTCAAACTTTCAACTTTTCCATCACATCAAATTTTTTCTACATACATAAATTTTCAATATTTTTTCTT[C/T,TAAAC]
TAATTTTAGTCAAACTTCCAATTTTAACGTGGAACTAAACACAACATTAGTAAGAAAAATTAAATCACTACATCATGACGCACACAAGTCTTCTTCCTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	42.30%	2.14%	0.23%	GTTTA: 0.42%
All Indica	2759	91.50%	4.10%	3.33%	0.33%	GTTTA: 0.69%
All Japonica	1512	0.30%	99.60%	0.00%	0.07%	NA
Aus	269	8.90%	89.20%	1.86%	0.00%	NA
Indica I	595	95.10%	1.80%	2.52%	0.34%	GTTTA: 0.17%
Indica II	465	89.20%	6.70%	3.66%	0.22%	GTTTA: 0.22%
Indica III	913	93.10%	1.50%	4.05%	0.22%	GTTTA: 1.10%
Indica Intermediate	786	88.30%	7.40%	2.93%	0.51%	GTTTA: 0.89%
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.20%	0.00%	0.41%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	38.90%	54.40%	4.44%	1.11%	GTTTA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303087401	G -> A	LOC_Os03g06139.1	upstream_gene_variant ; 1412.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N
vg0303087401	G -> A	LOC_Os03g06160.1	upstream_gene_variant ; 4456.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N
vg0303087401	G -> A	LOC_Os03g06139-LOC_Os03g06160	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N
vg0303087401	G -> GTTTA	LOC_Os03g06139.1	upstream_gene_variant ; 1413.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N
vg0303087401	G -> GTTTA	LOC_Os03g06160.1	upstream_gene_variant ; 4455.0bp to feature; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N
vg0303087401	G -> GTTTA	LOC_Os03g06139-LOC_Os03g06160	intergenic_region ; MODIFIER	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N
vg0303087401	G -> DEL	N	N	silent_mutation	Average:50.038; most accessible tissue: Callus, score: 68.156	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303087401	NA	4.11E-33	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.38E-21	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	2.29E-52	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	2.53E-58	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	2.48E-33	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	5.76E-29	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.41E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	3.96E-24	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	7.41E-07	mr1706	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.10E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	8.93E-14	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.30E-22	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	6.42E-56	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	3.65E-34	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	7.39E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	4.81E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	2.45E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	8.73E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.07E-33	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.49E-30	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	6.21E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.92E-30	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	2.80E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	3.02E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	3.50E-22	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303087401	NA	1.88E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251