| Variant ID: vg0303086467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 3086467 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTAGTTATACATCTACCTTACATAAGCCAAAAAAAACTTCTCCAACCTAGCTTTTGGCTTAATAGTGTTAGAGTGGCTTATGGCTTCCAAAAAGCCAAA[C/T]
GGAAAAGCTGCTTGTTTGTTTAGGTTTAGACTTTTCGACTTATAAGTTGGCTTATAAGCCTAAACAAAGAGGGCCTTAGCCCCTCCGCACAAATTGAGGC
GCCTCAATTTGTGCGGAGGGGCTAAGGCCCTCTTTGTTTAGGCTTATAAGCCAACTTATAAGTCGAAAAGTCTAAACCTAAACAAACAAGCAGCTTTTCC[G/A]
TTTGGCTTTTTGGAAGCCATAAGCCACTCTAACACTATTAAGCCAAAAGCTAGGTTGGAGAAGTTTTTTTTGGCTTATGTAAGGTAGATGTATAACTAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 11.20% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.90% | 11.20% | 0.86% | 0.00% | NA |
| Aus | 269 | 12.60% | 87.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 1.60% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 88.90% | 10.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 43.20% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0303086467 | C -> T | LOC_Os03g06139.1 | upstream_gene_variant ; 478.0bp to feature; MODIFIER | silent_mutation | Average:74.948; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 | N | N | N | N |
| vg0303086467 | C -> T | LOC_Os03g06139-LOC_Os03g06160 | intergenic_region ; MODIFIER | silent_mutation | Average:74.948; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0303086467 | NA | 1.88E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 2.54E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 1.06E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 1.31E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 1.24E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 3.82E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 5.40E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 6.67E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 1.59E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0303086467 | NA | 3.43E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/