\
| Variant ID: vg0302837094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 2837094 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 304. )
TAATATTGAAGCACTCATTTGATTGTATATTTTAATCATTACCTCTAATGCTTTCTGTGCCCATTTATATTAACAAGTATGCTAAATCATTATCATAGCA[C/T]
ACACTTATGAGTCTGCTGGATTCATTTTATTTTCAGGAACCCTAGAGAACTACTGTCTGGAATCCGAACTTCTCGTCTAAGAGATCGTAAAAAAGAAGAC
GTCTTCTTTTTTACGATCTCTTAGACGAGAAGTTCGGATTCCAGACAGTAGTTCTCTAGGGTTCCTGAAAATAAAATGAATCCAGCAGACTCATAAGTGT[G/A]
TGCTATGATAATGATTTAGCATACTTGTTAATATAAATGGGCACAGAAAGCATTAGAGGTAATGATTAAAATATACAATCAAATGAGTGCTTCAATATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 2.20% | 1.31% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 3.80% | 2.21% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.40% | 10.30% | 6.39% | 0.00% | NA |
| Indica II | 465 | 95.70% | 2.40% | 1.94% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 4.20% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0302837094 | C -> T | LOC_Os03g05690.1 | upstream_gene_variant ; 1678.0bp to feature; MODIFIER | silent_mutation | Average:45.165; most accessible tissue: Minghui63 flower, score: 56.131 | N | N | N | N |
| vg0302837094 | C -> T | LOC_Os03g05700.1 | downstream_gene_variant ; 4696.0bp to feature; MODIFIER | silent_mutation | Average:45.165; most accessible tissue: Minghui63 flower, score: 56.131 | N | N | N | N |
| vg0302837094 | C -> T | LOC_Os03g05680.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.165; most accessible tissue: Minghui63 flower, score: 56.131 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0302837094 | 4.29E-06 | 4.29E-06 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |